FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629349_at:

>probe:Drosophila_2:1629349_at:252:179; Interrogation_Position=133; Antisense; AAACATTTGGATCCGCGGGCGCGAA
>probe:Drosophila_2:1629349_at:321:373; Interrogation_Position=184; Antisense; GAAGTGTCGACAGGTCAGCGCACTC
>probe:Drosophila_2:1629349_at:692:277; Interrogation_Position=222; Antisense; CTATCGCCAGCTGATCATTGACAAC
>probe:Drosophila_2:1629349_at:258:199; Interrogation_Position=244; Antisense; AACGATCAATGCTTGGCCGTGCTGA
>probe:Drosophila_2:1629349_at:575:615; Interrogation_Position=266; Antisense; TGAATTGGAGCTCCGTGTCCCAAGG
>probe:Drosophila_2:1629349_at:379:167; Interrogation_Position=332; Antisense; AAATGTTAACCTATCACCTGCCCAT
>probe:Drosophila_2:1629349_at:465:413; Interrogation_Position=375; Antisense; GACCACGTGGAAATCCCTCTTAAAG
>probe:Drosophila_2:1629349_at:557:599; Interrogation_Position=456; Antisense; TGTCTATCTGTTTTGGCTCCTTTCA
>probe:Drosophila_2:1629349_at:534:331; Interrogation_Position=489; Antisense; GCGGCGTCCCATTTATGCAAATTTA
>probe:Drosophila_2:1629349_at:282:265; Interrogation_Position=535; Antisense; CAGAGCGTCTATAGGCGGAATCGTC
>probe:Drosophila_2:1629349_at:173:543; Interrogation_Position=563; Antisense; GGATACGCAACTTTGCCAGTCGGAT
>probe:Drosophila_2:1629349_at:202:501; Interrogation_Position=581; Antisense; GTCGGATGCCCATTAGACAGTTCAT
>probe:Drosophila_2:1629349_at:476:197; Interrogation_Position=607; Antisense; AACGGGCTAGATCCATACTTTGTCA
>probe:Drosophila_2:1629349_at:565:541; Interrogation_Position=680; Antisense; GGTTCTCCATCTACTTCGAGGTTAT

Paste this into a BLAST search page for me
AAACATTTGGATCCGCGGGCGCGAAGAAGTGTCGACAGGTCAGCGCACTCCTATCGCCAGCTGATCATTGACAACAACGATCAATGCTTGGCCGTGCTGATGAATTGGAGCTCCGTGTCCCAAGGAAATGTTAACCTATCACCTGCCCATGACCACGTGGAAATCCCTCTTAAAGTGTCTATCTGTTTTGGCTCCTTTCAGCGGCGTCCCATTTATGCAAATTTACAGAGCGTCTATAGGCGGAATCGTCGGATACGCAACTTTGCCAGTCGGATGTCGGATGCCCATTAGACAGTTCATAACGGGCTAGATCCATACTTTGTCAGGTTCTCCATCTACTTCGAGGTTAT

Full Affymetrix probeset data:

Annotations for 1629349_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720