FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629350_at:

>probe:Drosophila_2:1629350_at:468:333; Interrogation_Position=102; Antisense; GCTGGTCGATCAACCCAAGATGCAA
>probe:Drosophila_2:1629350_at:616:213; Interrogation_Position=118; Antisense; AAGATGCAATTCATGCGGACGGTCA
>probe:Drosophila_2:1629350_at:271:647; Interrogation_Position=128; Antisense; TCATGCGGACGGTCAAGGGACCTGT
>probe:Drosophila_2:1629350_at:246:413; Interrogation_Position=146; Antisense; GACCTGTGCGTCTGGGAGATATCGT
>probe:Drosophila_2:1629350_at:249:543; Interrogation_Position=171; Antisense; GGATTTCGAGGACACTGAGTTGACA
>probe:Drosophila_2:1629350_at:292:557; Interrogation_Position=180; Antisense; GGACACTGAGTTGACATGGCAATCT
>probe:Drosophila_2:1629350_at:237:153; Interrogation_Position=193; Antisense; ACATGGCAATCTTCGAGCAGGAGCA
>probe:Drosophila_2:1629350_at:138:717; Interrogation_Position=204; Antisense; TTCGAGCAGGAGCAATAGCAATTTT
>probe:Drosophila_2:1629350_at:1:637; Interrogation_Position=26; Antisense; TCGCTTCCAAGGCTCGTGTCATAAA
>probe:Drosophila_2:1629350_at:299:573; Interrogation_Position=36; Antisense; GGCTCGTGTCATAAAAATTCTCAAT
>probe:Drosophila_2:1629350_at:116:13; Interrogation_Position=52; Antisense; ATTCTCAATCGGATTGGAGCCCGAG
>probe:Drosophila_2:1629350_at:471:553; Interrogation_Position=67; Antisense; GGAGCCCGAGGCATTCTAACCGAAG
>probe:Drosophila_2:1629350_at:417:439; Interrogation_Position=74; Antisense; GAGGCATTCTAACCGAAGTTCGTGT
>probe:Drosophila_2:1629350_at:305:217; Interrogation_Position=89; Antisense; AAGTTCGTGTGCAGCTGGTCGATCA

Paste this into a BLAST search page for me
GCTGGTCGATCAACCCAAGATGCAAAAGATGCAATTCATGCGGACGGTCATCATGCGGACGGTCAAGGGACCTGTGACCTGTGCGTCTGGGAGATATCGTGGATTTCGAGGACACTGAGTTGACAGGACACTGAGTTGACATGGCAATCTACATGGCAATCTTCGAGCAGGAGCATTCGAGCAGGAGCAATAGCAATTTTTCGCTTCCAAGGCTCGTGTCATAAAGGCTCGTGTCATAAAAATTCTCAATATTCTCAATCGGATTGGAGCCCGAGGGAGCCCGAGGCATTCTAACCGAAGGAGGCATTCTAACCGAAGTTCGTGTAAGTTCGTGTGCAGCTGGTCGATCA

Full Affymetrix probeset data:

Annotations for 1629350_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720