FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629352_at:

>probe:Drosophila_2:1629352_at:84:395; Interrogation_Position=1745; Antisense; GAAATTTCCAGTATTTGCGAGACTA
>probe:Drosophila_2:1629352_at:399:47; Interrogation_Position=1780; Antisense; ATCCGTATTCTTTTCTGTAGCTGAG
>probe:Drosophila_2:1629352_at:18:677; Interrogation_Position=1812; Antisense; TAGATTGGGTCGATTAAGCTTAAGT
>probe:Drosophila_2:1629352_at:550:367; Interrogation_Position=1858; Antisense; GAATCGTTTCAAATCATCAGAGGAC
>probe:Drosophila_2:1629352_at:537:649; Interrogation_Position=1874; Antisense; TCAGAGGACTCTGTCAGTTTTAAGT
>probe:Drosophila_2:1629352_at:525:15; Interrogation_Position=2074; Antisense; ATTATGTAGCTTTCCCCATATCGAC
>probe:Drosophila_2:1629352_at:78:43; Interrogation_Position=2093; Antisense; ATCGACCCAAACTAACGAGTGTGTT
>probe:Drosophila_2:1629352_at:559:171; Interrogation_Position=2129; Antisense; AAAGTATTCAACTAGGCACACCCGC
>probe:Drosophila_2:1629352_at:325:133; Interrogation_Position=2161; Antisense; ACCCTCGAACCGTATTTGTATTCAT
>probe:Drosophila_2:1629352_at:128:693; Interrogation_Position=2175; Antisense; TTTGTATTCATATTCCTATTCCTAT
>probe:Drosophila_2:1629352_at:602:45; Interrogation_Position=2210; Antisense; ATCCGCCACTCGAGGATCGGTAGTT
>probe:Drosophila_2:1629352_at:310:537; Interrogation_Position=2228; Antisense; GGTAGTTGCAATATTAAGTCCCAGC
>probe:Drosophila_2:1629352_at:264:289; Interrogation_Position=2273; Antisense; CGGCGGGCCAATAAAAACCAGCATT
>probe:Drosophila_2:1629352_at:41:203; Interrogation_Position=2288; Antisense; AACCAGCATTTACACGAGAGCATGT

Paste this into a BLAST search page for me
GAAATTTCCAGTATTTGCGAGACTAATCCGTATTCTTTTCTGTAGCTGAGTAGATTGGGTCGATTAAGCTTAAGTGAATCGTTTCAAATCATCAGAGGACTCAGAGGACTCTGTCAGTTTTAAGTATTATGTAGCTTTCCCCATATCGACATCGACCCAAACTAACGAGTGTGTTAAAGTATTCAACTAGGCACACCCGCACCCTCGAACCGTATTTGTATTCATTTTGTATTCATATTCCTATTCCTATATCCGCCACTCGAGGATCGGTAGTTGGTAGTTGCAATATTAAGTCCCAGCCGGCGGGCCAATAAAAACCAGCATTAACCAGCATTTACACGAGAGCATGT

Full Affymetrix probeset data:

Annotations for 1629352_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720