Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629355_at:

>probe:Drosophila_2:1629355_at:156:455; Interrogation_Position=6382; Antisense; GATAACGACCTTTATGATCTTCTTT
>probe:Drosophila_2:1629355_at:203:453; Interrogation_Position=6397; Antisense; GATCTTCTTTTTTCTAGTATTGTTA
>probe:Drosophila_2:1629355_at:243:565; Interrogation_Position=6447; Antisense; GGAATCTATGTCCACAGTCTTTCAC
>probe:Drosophila_2:1629355_at:88:499; Interrogation_Position=6463; Antisense; GTCTTTCACCAAGTTGACTGTCTCT
>probe:Drosophila_2:1629355_at:416:285; Interrogation_Position=6480; Antisense; CTGTCTCTCAGATAAAATGTCTCTT
>probe:Drosophila_2:1629355_at:22:357; Interrogation_Position=6539; Antisense; GCAAAAAATACTCTTCGACAATGGT
>probe:Drosophila_2:1629355_at:461:249; Interrogation_Position=6635; Antisense; CAATTACTTTAGTCAGGCCGGCTGA
>probe:Drosophila_2:1629355_at:671:317; Interrogation_Position=6651; Antisense; GCCGGCTGAGGCTTCATTGCAAGAT
>probe:Drosophila_2:1629355_at:668:443; Interrogation_Position=6679; Antisense; GATGAGGACTACTGCATTTCGTTAC
>probe:Drosophila_2:1629355_at:177:285; Interrogation_Position=6690; Antisense; CTGCATTTCGTTACTTACATCTGGG
>probe:Drosophila_2:1629355_at:695:443; Interrogation_Position=6787; Antisense; GATGATTTTGATCCAGTACTTCTGG
>probe:Drosophila_2:1629355_at:331:395; Interrogation_Position=6844; Antisense; GACAAGCCGGTTTCAGTAGTATAAT
>probe:Drosophila_2:1629355_at:712:685; Interrogation_Position=6878; Antisense; TATAACTTTCAGCTGTTCCACTTGA
>probe:Drosophila_2:1629355_at:270:263; Interrogation_Position=6887; Antisense; CAGCTGTTCCACTTGATTTCAATTA

Paste this into a BLAST search page for me
GATAACGACCTTTATGATCTTCTTTGATCTTCTTTTTTCTAGTATTGTTAGGAATCTATGTCCACAGTCTTTCACGTCTTTCACCAAGTTGACTGTCTCTCTGTCTCTCAGATAAAATGTCTCTTGCAAAAAATACTCTTCGACAATGGTCAATTACTTTAGTCAGGCCGGCTGAGCCGGCTGAGGCTTCATTGCAAGATGATGAGGACTACTGCATTTCGTTACCTGCATTTCGTTACTTACATCTGGGGATGATTTTGATCCAGTACTTCTGGGACAAGCCGGTTTCAGTAGTATAATTATAACTTTCAGCTGTTCCACTTGACAGCTGTTCCACTTGATTTCAATTA

Full Affymetrix probeset data:

Annotations for 1629355_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime