FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629356_at:

>probe:Drosophila_2:1629356_at:497:85; Interrogation_Position=4534; Antisense; AGTGCAGCACATCAAGCGGGCCATT
>probe:Drosophila_2:1629356_at:570:425; Interrogation_Position=4574; Antisense; GATGATGACCAGCTCCTAAAGACCG
>probe:Drosophila_2:1629356_at:561:3; Interrogation_Position=4610; Antisense; ATTGGCGAGATGTTCCAGCACAACA
>probe:Drosophila_2:1629356_at:680:91; Interrogation_Position=4635; Antisense; AGATTCTTGATCTGAACCGCCTTTA
>probe:Drosophila_2:1629356_at:439:611; Interrogation_Position=4666; Antisense; TGACATTCACGCGATTGCTAGGACG
>probe:Drosophila_2:1629356_at:319:377; Interrogation_Position=4700; Antisense; GAAGCAGCGTCTCAAGTGATCGTTA
>probe:Drosophila_2:1629356_at:92:141; Interrogation_Position=4752; Antisense; ACGGAATTACTGTGGATCGCCGCCA
>probe:Drosophila_2:1629356_at:403:131; Interrogation_Position=4776; Antisense; ACCTGTCGCTAATTGCCGATTACAT
>probe:Drosophila_2:1629356_at:665:461; Interrogation_Position=4793; Antisense; GATTACATGACCTTCGACGGCACTT
>probe:Drosophila_2:1629356_at:615:253; Interrogation_Position=4820; Antisense; CAACCGTTGTCACGCAAGGGCATGG
>probe:Drosophila_2:1629356_at:55:619; Interrogation_Position=4863; Antisense; TGCAGCAGATGTCCTTCGAGTCCAG
>probe:Drosophila_2:1629356_at:54:433; Interrogation_Position=4880; Antisense; GAGTCCAGCTTGCAGTTCCTCAAGA
>probe:Drosophila_2:1629356_at:284:291; Interrogation_Position=4944; Antisense; CGTCGAGTCGTTTGATGGTTGGCCT
>probe:Drosophila_2:1629356_at:172:287; Interrogation_Position=4986; Antisense; CTGGTGCCTTTGAGTTGCTGACGAA

Paste this into a BLAST search page for me
AGTGCAGCACATCAAGCGGGCCATTGATGATGACCAGCTCCTAAAGACCGATTGGCGAGATGTTCCAGCACAACAAGATTCTTGATCTGAACCGCCTTTATGACATTCACGCGATTGCTAGGACGGAAGCAGCGTCTCAAGTGATCGTTAACGGAATTACTGTGGATCGCCGCCAACCTGTCGCTAATTGCCGATTACATGATTACATGACCTTCGACGGCACTTCAACCGTTGTCACGCAAGGGCATGGTGCAGCAGATGTCCTTCGAGTCCAGGAGTCCAGCTTGCAGTTCCTCAAGACGTCGAGTCGTTTGATGGTTGGCCTCTGGTGCCTTTGAGTTGCTGACGAA

Full Affymetrix probeset data:

Annotations for 1629356_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720