Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629358_s_at:

>probe:Drosophila_2:1629358_s_at:234:341; Interrogation_Position=1024; Antisense; GCATTCCTTAAAAGATCCCCTTGTA
>probe:Drosophila_2:1629358_s_at:121:267; Interrogation_Position=1100; Antisense; CAGTGGTGTTAGACTACCTGCTAAA
>probe:Drosophila_2:1629358_s_at:310:673; Interrogation_Position=543; Antisense; TACCTATCCGCCAATGTGAACTTCA
>probe:Drosophila_2:1629358_s_at:59:53; Interrogation_Position=602; Antisense; ATGCTGCGGCAACCAACCAACAAGT
>probe:Drosophila_2:1629358_s_at:255:405; Interrogation_Position=633; Antisense; GACTCCACCCAGATGACCTGTATGG
>probe:Drosophila_2:1629358_s_at:46:681; Interrogation_Position=653; Antisense; TATGGAGACCTACGACTACGGCTGC
>probe:Drosophila_2:1629358_s_at:655:335; Interrogation_Position=673; Antisense; GCTGCTTCCGCAAGATGAACTTCAT
>probe:Drosophila_2:1629358_s_at:568:385; Interrogation_Position=689; Antisense; GAACTTCATTGTGTCGCAGAGCGCC
>probe:Drosophila_2:1629358_s_at:236:625; Interrogation_Position=771; Antisense; TGCGCCTTTATGCTGGCCAAGACGC
>probe:Drosophila_2:1629358_s_at:723:559; Interrogation_Position=870; Antisense; GGAAAGATGGCACCGCCCCAGAATT
>probe:Drosophila_2:1629358_s_at:640:597; Interrogation_Position=899; Antisense; TGTCACCGGCTATCAGCAGTTGGAT
>probe:Drosophila_2:1629358_s_at:635:659; Interrogation_Position=923; Antisense; TAACGGAGAGCAGGGCTCCCACGAA
>probe:Drosophila_2:1629358_s_at:85:265; Interrogation_Position=966; Antisense; CAGAGCCCCAGCGTTAACTAAGCGG
>probe:Drosophila_2:1629358_s_at:309:207; Interrogation_Position=985; Antisense; AAGCGGCGACATCGATCGAAGCCAT

Paste this into a BLAST search page for me
GCATTCCTTAAAAGATCCCCTTGTACAGTGGTGTTAGACTACCTGCTAAATACCTATCCGCCAATGTGAACTTCAATGCTGCGGCAACCAACCAACAAGTGACTCCACCCAGATGACCTGTATGGTATGGAGACCTACGACTACGGCTGCGCTGCTTCCGCAAGATGAACTTCATGAACTTCATTGTGTCGCAGAGCGCCTGCGCCTTTATGCTGGCCAAGACGCGGAAAGATGGCACCGCCCCAGAATTTGTCACCGGCTATCAGCAGTTGGATTAACGGAGAGCAGGGCTCCCACGAACAGAGCCCCAGCGTTAACTAAGCGGAAGCGGCGACATCGATCGAAGCCAT

Full Affymetrix probeset data:

Annotations for 1629358_s_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime