FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629359_at:

>probe:Drosophila_2:1629359_at:604:113; Interrogation_Position=1000; Antisense; AGCATCCAGGCCTTCAAAATTCTGC
>probe:Drosophila_2:1629359_at:657:183; Interrogation_Position=1015; Antisense; AAAATTCTGCGCGAAGCCTACTACA
>probe:Drosophila_2:1629359_at:654:377; Interrogation_Position=1027; Antisense; GAAGCCTACTACATGCAGCTGGAAC
>probe:Drosophila_2:1629359_at:222:421; Interrogation_Position=1069; Antisense; GAGCAACCCGAACTGGCCAAATGGC
>probe:Drosophila_2:1629359_at:344:549; Interrogation_Position=1116; Antisense; GGAGAATCGTCTGAAGGCTTCGGCA
>probe:Drosophila_2:1629359_at:700:225; Interrogation_Position=1129; Antisense; AAGGCTTCGGCAGCTGCCAGCAAAA
>probe:Drosophila_2:1629359_at:554:375; Interrogation_Position=705; Antisense; GAAGAAGAAATCACGTCCCACCAAG
>probe:Drosophila_2:1629359_at:491:145; Interrogation_Position=765; Antisense; ACTAACCATGCCAGCGATGCGAAAG
>probe:Drosophila_2:1629359_at:448:551; Interrogation_Position=799; Antisense; GGAGCAAACCCTGCGGTCGATTCAA
>probe:Drosophila_2:1629359_at:723:219; Interrogation_Position=838; Antisense; AAGTGCGAACGCACATTCGTTACAA
>probe:Drosophila_2:1629359_at:420:249; Interrogation_Position=882; Antisense; CAAGGTGTTTCAAAGCCTCTTCCGC
>probe:Drosophila_2:1629359_at:247:229; Interrogation_Position=931; Antisense; AATGGCATCTGTCCAATCACCAGGC
>probe:Drosophila_2:1629359_at:409:707; Interrogation_Position=966; Antisense; TTACTTTGACCCGATCACACAGCAG
>probe:Drosophila_2:1629359_at:445:153; Interrogation_Position=984; Antisense; ACAGCAGCCATACTACAGCATCCAG

Paste this into a BLAST search page for me
AGCATCCAGGCCTTCAAAATTCTGCAAAATTCTGCGCGAAGCCTACTACAGAAGCCTACTACATGCAGCTGGAACGAGCAACCCGAACTGGCCAAATGGCGGAGAATCGTCTGAAGGCTTCGGCAAAGGCTTCGGCAGCTGCCAGCAAAAGAAGAAGAAATCACGTCCCACCAAGACTAACCATGCCAGCGATGCGAAAGGGAGCAAACCCTGCGGTCGATTCAAAAGTGCGAACGCACATTCGTTACAACAAGGTGTTTCAAAGCCTCTTCCGCAATGGCATCTGTCCAATCACCAGGCTTACTTTGACCCGATCACACAGCAGACAGCAGCCATACTACAGCATCCAG

Full Affymetrix probeset data:

Annotations for 1629359_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720