FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629360_at:

>probe:Drosophila_2:1629360_at:362:31; Interrogation_Position=452; Antisense; ATAAAGAGGTATGCGATATGGGCCA
>probe:Drosophila_2:1629360_at:447:23; Interrogation_Position=467; Antisense; ATATGGGCCAGGAACTCAGCGAATA
>probe:Drosophila_2:1629360_at:361:521; Interrogation_Position=471; Antisense; GGGCCAGGAACTCAGCGAATACAGA
>probe:Drosophila_2:1629360_at:422:29; Interrogation_Position=489; Antisense; ATACAGAGAAGTAGTCGCCCCGTCT
>probe:Drosophila_2:1629360_at:626:147; Interrogation_Position=536; Antisense; ACTTCCTCACTTCGGCACGGCGGGA
>probe:Drosophila_2:1629360_at:40:449; Interrogation_Position=566; Antisense; GATCCCTTAAAGTCGTCCTTGTGTC
>probe:Drosophila_2:1629360_at:362:705; Interrogation_Position=572; Antisense; TTAAAGTCGTCCTTGTGTCCCGCTG
>probe:Drosophila_2:1629360_at:441:593; Interrogation_Position=585; Antisense; TGTGTCCCGCTGCACTGCGTCAACG
>probe:Drosophila_2:1629360_at:180:145; Interrogation_Position=598; Antisense; ACTGCGTCAACGCTTGGCCTTGTTT
>probe:Drosophila_2:1629360_at:359:329; Interrogation_Position=601; Antisense; GCGTCAACGCTTGGCCTTGTTTTTT
>probe:Drosophila_2:1629360_at:480:643; Interrogation_Position=631; Antisense; TCTTTTCATTGGTTTGTTTGCCGCG
>probe:Drosophila_2:1629360_at:379:3; Interrogation_Position=638; Antisense; ATTGGTTTGTTTGCCGCGCTCGTAA
>probe:Drosophila_2:1629360_at:542:477; Interrogation_Position=646; Antisense; GTTTGCCGCGCTCGTAATGAAATTT
>probe:Drosophila_2:1629360_at:508:319; Interrogation_Position=650; Antisense; GCCGCGCTCGTAATGAAATTTGTAA

Paste this into a BLAST search page for me
ATAAAGAGGTATGCGATATGGGCCAATATGGGCCAGGAACTCAGCGAATAGGGCCAGGAACTCAGCGAATACAGAATACAGAGAAGTAGTCGCCCCGTCTACTTCCTCACTTCGGCACGGCGGGAGATCCCTTAAAGTCGTCCTTGTGTCTTAAAGTCGTCCTTGTGTCCCGCTGTGTGTCCCGCTGCACTGCGTCAACGACTGCGTCAACGCTTGGCCTTGTTTGCGTCAACGCTTGGCCTTGTTTTTTTCTTTTCATTGGTTTGTTTGCCGCGATTGGTTTGTTTGCCGCGCTCGTAAGTTTGCCGCGCTCGTAATGAAATTTGCCGCGCTCGTAATGAAATTTGTAA

Full Affymetrix probeset data:

Annotations for 1629360_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720