FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629362_at:

>probe:Drosophila_2:1629362_at:87:15; Interrogation_Position=2387; Antisense; ATTAGCGGTTTCTTCTATGTCCTGA
>probe:Drosophila_2:1629362_at:90:681; Interrogation_Position=2402; Antisense; TATGTCCTGAGCCAGATCTACATCC
>probe:Drosophila_2:1629362_at:165:453; Interrogation_Position=2416; Antisense; GATCTACATCCGTGATCAGCCAGAT
>probe:Drosophila_2:1629362_at:498:371; Interrogation_Position=2497; Antisense; GAAGTACTTTGGCTACACGGCAGTC
>probe:Drosophila_2:1629362_at:142:485; Interrogation_Position=2522; Antisense; GTATGGGTCGTTTGCATATGCTCCT
>probe:Drosophila_2:1629362_at:170:23; Interrogation_Position=2537; Antisense; ATATGCTCCTTTGCCTTTAACTACT
>probe:Drosophila_2:1629362_at:308:95; Interrogation_Position=2573; Antisense; AGATCCCACCTTAACTACGCTGTAA
>probe:Drosophila_2:1629362_at:124:673; Interrogation_Position=2588; Antisense; TACGCTGTAAGCTTCTGCATGGCCT
>probe:Drosophila_2:1629362_at:338:321; Interrogation_Position=2627; Antisense; GCCCTCTATGCGCTGATTGGAAAGA
>probe:Drosophila_2:1629362_at:281:235; Interrogation_Position=2659; Antisense; AATCCAAAATTTTCTGCGGCGCATA
>probe:Drosophila_2:1629362_at:224:597; Interrogation_Position=2702; Antisense; TGTGAAAACTCAGTTCCGCTCTCGA
>probe:Drosophila_2:1629362_at:572:631; Interrogation_Position=2716; Antisense; TCCGCTCTCGAGTTTTGGTTAACTT
>probe:Drosophila_2:1629362_at:692:473; Interrogation_Position=2733; Antisense; GTTAACTTTTCTTGTTGTGCCCACT
>probe:Drosophila_2:1629362_at:412:727; Interrogation_Position=2747; Antisense; TTGTGCCCACTGTAGCGTTAGTGTA

Paste this into a BLAST search page for me
ATTAGCGGTTTCTTCTATGTCCTGATATGTCCTGAGCCAGATCTACATCCGATCTACATCCGTGATCAGCCAGATGAAGTACTTTGGCTACACGGCAGTCGTATGGGTCGTTTGCATATGCTCCTATATGCTCCTTTGCCTTTAACTACTAGATCCCACCTTAACTACGCTGTAATACGCTGTAAGCTTCTGCATGGCCTGCCCTCTATGCGCTGATTGGAAAGAAATCCAAAATTTTCTGCGGCGCATATGTGAAAACTCAGTTCCGCTCTCGATCCGCTCTCGAGTTTTGGTTAACTTGTTAACTTTTCTTGTTGTGCCCACTTTGTGCCCACTGTAGCGTTAGTGTA

Full Affymetrix probeset data:

Annotations for 1629362_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720