FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629363_at:

>probe:Drosophila_2:1629363_at:728:469; Interrogation_Position=124; Antisense; GTTGCCAAGCAGATATTTGCCCTCG
>probe:Drosophila_2:1629363_at:438:693; Interrogation_Position=139; Antisense; TTTGCCCTCGATTTCGAGATCTTTG
>probe:Drosophila_2:1629363_at:147:431; Interrogation_Position=167; Antisense; GAGTGCAAGGTGTGTTCTTCCGCAA
>probe:Drosophila_2:1629363_at:232:359; Interrogation_Position=188; Antisense; GCAAACACACGTCGCATGAGGCTAA
>probe:Drosophila_2:1629363_at:655:189; Interrogation_Position=23; Antisense; AACATTCAGTTTTTGCTAGCTCTAT
>probe:Drosophila_2:1629363_at:621:611; Interrogation_Position=239; Antisense; TGAATACCCGGGATGGGACCGTCAA
>probe:Drosophila_2:1629363_at:375:653; Interrogation_Position=260; Antisense; TCAAGGGACAACTGGAGGCTCCTAT
>probe:Drosophila_2:1629363_at:238:569; Interrogation_Position=311; Antisense; GGCTGGAGAACAACCGAATTCCCAA
>probe:Drosophila_2:1629363_at:648:361; Interrogation_Position=326; Antisense; GAATTCCCAACGCTAAGGTCTCAAA
>probe:Drosophila_2:1629363_at:393:535; Interrogation_Position=342; Antisense; GGTCTCAAAGGCTGAATTTTCGCAA
>probe:Drosophila_2:1629363_at:398:403; Interrogation_Position=382; Antisense; GACTATACGTTCACTTCCTTTGACA
>probe:Drosophila_2:1629363_at:524:15; Interrogation_Position=424; Antisense; ATTATTAGCTCTTTCGTTGTCCATC
>probe:Drosophila_2:1629363_at:69:633; Interrogation_Position=437; Antisense; TCGTTGTCCATCCAATTCCGAAACA
>probe:Drosophila_2:1629363_at:656:453; Interrogation_Position=94; Antisense; GATCACGACTACATAATGGCGGGAT

Paste this into a BLAST search page for me
GTTGCCAAGCAGATATTTGCCCTCGTTTGCCCTCGATTTCGAGATCTTTGGAGTGCAAGGTGTGTTCTTCCGCAAGCAAACACACGTCGCATGAGGCTAAAACATTCAGTTTTTGCTAGCTCTATTGAATACCCGGGATGGGACCGTCAATCAAGGGACAACTGGAGGCTCCTATGGCTGGAGAACAACCGAATTCCCAAGAATTCCCAACGCTAAGGTCTCAAAGGTCTCAAAGGCTGAATTTTCGCAAGACTATACGTTCACTTCCTTTGACAATTATTAGCTCTTTCGTTGTCCATCTCGTTGTCCATCCAATTCCGAAACAGATCACGACTACATAATGGCGGGAT

Full Affymetrix probeset data:

Annotations for 1629363_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720