FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629365_at:

>probe:Drosophila_2:1629365_at:181:205; Interrogation_Position=211; Antisense; AAGCGGTACTGCTACCATGGTGGAA
>probe:Drosophila_2:1629365_at:353:511; Interrogation_Position=280; Antisense; GTGAAACTCGACCAGGAGCTGCTGT
>probe:Drosophila_2:1629365_at:557:563; Interrogation_Position=333; Antisense; GGAAGTTCCAATCCGAATGGCCAAG
>probe:Drosophila_2:1629365_at:286:209; Interrogation_Position=361; Antisense; AAGCAGTATCGCCTGGAAGCTCGAC
>probe:Drosophila_2:1629365_at:626:569; Interrogation_Position=387; Antisense; GGCTACTCCCGAACTGGCAAAATTT
>probe:Drosophila_2:1629365_at:6:433; Interrogation_Position=435; Antisense; GAGGGCGGAGTATCCATCGTACTAT
>probe:Drosophila_2:1629365_at:221:35; Interrogation_Position=458; Antisense; ATCTCCCGGATCGATACTTTGGTAA
>probe:Drosophila_2:1629365_at:462:163; Interrogation_Position=484; Antisense; AAATTCTACGAGTTGCCAGGACCGC
>probe:Drosophila_2:1629365_at:51:225; Interrogation_Position=514; Antisense; AAGGAGACCCAGACGGACATTCCGA
>probe:Drosophila_2:1629365_at:263:401; Interrogation_Position=529; Antisense; GACATTCCGATTGGGCGTTACGGCA
>probe:Drosophila_2:1629365_at:516:667; Interrogation_Position=547; Antisense; TACGGCATCGATGGTTGTCCCTGTA
>probe:Drosophila_2:1629365_at:98:599; Interrogation_Position=562; Antisense; TGTCCCTGTACCAATAAATCGCTCT
>probe:Drosophila_2:1629365_at:643:165; Interrogation_Position=577; Antisense; AAATCGCTCTGCTATGACTTGTAAT
>probe:Drosophila_2:1629365_at:158:147; Interrogation_Position=94; Antisense; ACTCTTTCCACAATGTTTTCCGATC

Paste this into a BLAST search page for me
AAGCGGTACTGCTACCATGGTGGAAGTGAAACTCGACCAGGAGCTGCTGTGGAAGTTCCAATCCGAATGGCCAAGAAGCAGTATCGCCTGGAAGCTCGACGGCTACTCCCGAACTGGCAAAATTTGAGGGCGGAGTATCCATCGTACTATATCTCCCGGATCGATACTTTGGTAAAAATTCTACGAGTTGCCAGGACCGCAAGGAGACCCAGACGGACATTCCGAGACATTCCGATTGGGCGTTACGGCATACGGCATCGATGGTTGTCCCTGTATGTCCCTGTACCAATAAATCGCTCTAAATCGCTCTGCTATGACTTGTAATACTCTTTCCACAATGTTTTCCGATC

Full Affymetrix probeset data:

Annotations for 1629365_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720