FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629366_at:

>probe:Drosophila_2:1629366_at:377:567; Interrogation_Position=1000; Antisense; GGCACAGTTATAAGTCCCAACCATG
>probe:Drosophila_2:1629366_at:723:411; Interrogation_Position=1060; Antisense; GACCGCTTCGCGTTTATTTATGCAG
>probe:Drosophila_2:1629366_at:257:703; Interrogation_Position=1073; Antisense; TTATTTATGCAGTCGGAGGCCCAAT
>probe:Drosophila_2:1629366_at:15:289; Interrogation_Position=1086; Antisense; CGGAGGCCCAATTAGTTTTCAGAAT
>probe:Drosophila_2:1629366_at:224:595; Interrogation_Position=531; Antisense; TGTGGAAACTCGACTGATGACCTGT
>probe:Drosophila_2:1629366_at:367:607; Interrogation_Position=545; Antisense; TGATGACCTGTGAGTCCTGCGGCGA
>probe:Drosophila_2:1629366_at:59:623; Interrogation_Position=592; Antisense; TGCGGCGACTTCAATTACGATCTGT
>probe:Drosophila_2:1629366_at:338:217; Interrogation_Position=697; Antisense; AAGTCATCGCGGATCGGTAGCCGAA
>probe:Drosophila_2:1629366_at:648:431; Interrogation_Position=779; Antisense; GAGTCCTAAGACCACGAGAGCTAAC
>probe:Drosophila_2:1629366_at:88:339; Interrogation_Position=798; Antisense; GCTAACCAAGACATCGAGTGCCGAT
>probe:Drosophila_2:1629366_at:116:425; Interrogation_Position=847; Antisense; GAGACTCCGTCACCTGCAAGGAATG
>probe:Drosophila_2:1629366_at:81:609; Interrogation_Position=878; Antisense; TGAGCTGTCGTCGTCGGCAATATGG
>probe:Drosophila_2:1629366_at:14:475; Interrogation_Position=911; Antisense; GTTCAAATGTCGTGACTGCCCAGGC
>probe:Drosophila_2:1629366_at:86:319; Interrogation_Position=934; Antisense; GCCCAGACCCAGTTGATACTTTTTT

Paste this into a BLAST search page for me
GGCACAGTTATAAGTCCCAACCATGGACCGCTTCGCGTTTATTTATGCAGTTATTTATGCAGTCGGAGGCCCAATCGGAGGCCCAATTAGTTTTCAGAATTGTGGAAACTCGACTGATGACCTGTTGATGACCTGTGAGTCCTGCGGCGATGCGGCGACTTCAATTACGATCTGTAAGTCATCGCGGATCGGTAGCCGAAGAGTCCTAAGACCACGAGAGCTAACGCTAACCAAGACATCGAGTGCCGATGAGACTCCGTCACCTGCAAGGAATGTGAGCTGTCGTCGTCGGCAATATGGGTTCAAATGTCGTGACTGCCCAGGCGCCCAGACCCAGTTGATACTTTTTT

Full Affymetrix probeset data:

Annotations for 1629366_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720