FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629368_at:

>probe:Drosophila_2:1629368_at:685:81; Interrogation_Position=2232; Antisense; AGTGGAAGAAGCAGAACCCCGGCAT
>probe:Drosophila_2:1629368_at:135:107; Interrogation_Position=2244; Antisense; AGAACCCCGGCATGGATGTCAACTC
>probe:Drosophila_2:1629368_at:269:525; Interrogation_Position=2310; Antisense; GGGCATATGCCAGCGGACTCCTGTA
>probe:Drosophila_2:1629368_at:683:649; Interrogation_Position=2397; Antisense; TCAGCCACTCGCACTCATAAAATTG
>probe:Drosophila_2:1629368_at:541:155; Interrogation_Position=2431; Antisense; ACAGCGATTGTTGCAACTGTTCGAA
>probe:Drosophila_2:1629368_at:39:617; Interrogation_Position=2442; Antisense; TGCAACTGTTCGAAAAGCGCGGCCG
>probe:Drosophila_2:1629368_at:26:659; Interrogation_Position=2548; Antisense; TAAGTGTGTGTTTAGTGTTCGACCA
>probe:Drosophila_2:1629368_at:701:513; Interrogation_Position=2562; Antisense; GTGTTCGACCAGAGATTTCCTTTGT
>probe:Drosophila_2:1629368_at:392:715; Interrogation_Position=2578; Antisense; TTCCTTTGTTACTTCGATTCTTTCG
>probe:Drosophila_2:1629368_at:394:463; Interrogation_Position=2593; Antisense; GATTCTTTCGATTACCCGCTGTATA
>probe:Drosophila_2:1629368_at:453:457; Interrogation_Position=2602; Antisense; GATTACCCGCTGTATATAGTTTTTG
>probe:Drosophila_2:1629368_at:305:145; Interrogation_Position=2639; Antisense; ACTATGCTAGTGCTTAGAACCTCGA
>probe:Drosophila_2:1629368_at:300:107; Interrogation_Position=2654; Antisense; AGAACCTCGAATGCCATATCTAGAT
>probe:Drosophila_2:1629368_at:486:13; Interrogation_Position=2691; Antisense; ATTACCTGTAGCGTTTAAGTGGCAA

Paste this into a BLAST search page for me
AGTGGAAGAAGCAGAACCCCGGCATAGAACCCCGGCATGGATGTCAACTCGGGCATATGCCAGCGGACTCCTGTATCAGCCACTCGCACTCATAAAATTGACAGCGATTGTTGCAACTGTTCGAATGCAACTGTTCGAAAAGCGCGGCCGTAAGTGTGTGTTTAGTGTTCGACCAGTGTTCGACCAGAGATTTCCTTTGTTTCCTTTGTTACTTCGATTCTTTCGGATTCTTTCGATTACCCGCTGTATAGATTACCCGCTGTATATAGTTTTTGACTATGCTAGTGCTTAGAACCTCGAAGAACCTCGAATGCCATATCTAGATATTACCTGTAGCGTTTAAGTGGCAA

Full Affymetrix probeset data:

Annotations for 1629368_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720