FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629369_at:

>probe:Drosophila_2:1629369_at:300:1; Interrogation_Position=3742; Antisense; CGTCGGCTAACGGATCAACTGAATA
>probe:Drosophila_2:1629369_at:486:195; Interrogation_Position=3758; Antisense; AACTGAATAGTTGCCGGCTGGAGCA
>probe:Drosophila_2:1629369_at:354:365; Interrogation_Position=3786; Antisense; GAATCTCAGTTATGTGCGCTGGCCC
>probe:Drosophila_2:1629369_at:260:321; Interrogation_Position=3807; Antisense; GCCCCTCGACGATGCAAGTGGATTT
>probe:Drosophila_2:1629369_at:283:417; Interrogation_Position=3841; Antisense; GAGCGCCTGGTTACGCTTTTCGAAG
>probe:Drosophila_2:1629369_at:506:221; Interrogation_Position=3863; Antisense; AAGGTGGTACCTGCGAGCGATTTGT
>probe:Drosophila_2:1629369_at:620:335; Interrogation_Position=3905; Antisense; GCTGCGGCTTGAACGATGCGCATAT
>probe:Drosophila_2:1629369_at:375:519; Interrogation_Position=4004; Antisense; GTGGAACTACTCTTGGATACATATT
>probe:Drosophila_2:1629369_at:74:15; Interrogation_Position=4044; Antisense; ATTACGCGATCTTTTGGCCGTTAAT
>probe:Drosophila_2:1629369_at:502:37; Interrogation_Position=4076; Antisense; ATCTACTGGATGACATTCGTCTGCA
>probe:Drosophila_2:1629369_at:42:337; Interrogation_Position=4122; Antisense; GCTGCCCAGGCGCTTAGAATTAACA
>probe:Drosophila_2:1629369_at:207:607; Interrogation_Position=4149; Antisense; TGATGAGCAGGTGTTCTCCATGCCA
>probe:Drosophila_2:1629369_at:289:389; Interrogation_Position=4183; Antisense; GAAACACTTCAGTCCATTTGGCAGC
>probe:Drosophila_2:1629369_at:25:171; Interrogation_Position=4273; Antisense; AAAGGTCTACTTAAGCTACTCGCTG

Paste this into a BLAST search page for me
CGTCGGCTAACGGATCAACTGAATAAACTGAATAGTTGCCGGCTGGAGCAGAATCTCAGTTATGTGCGCTGGCCCGCCCCTCGACGATGCAAGTGGATTTGAGCGCCTGGTTACGCTTTTCGAAGAAGGTGGTACCTGCGAGCGATTTGTGCTGCGGCTTGAACGATGCGCATATGTGGAACTACTCTTGGATACATATTATTACGCGATCTTTTGGCCGTTAATATCTACTGGATGACATTCGTCTGCAGCTGCCCAGGCGCTTAGAATTAACATGATGAGCAGGTGTTCTCCATGCCAGAAACACTTCAGTCCATTTGGCAGCAAAGGTCTACTTAAGCTACTCGCTG

Full Affymetrix probeset data:

Annotations for 1629369_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720