FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629371_at:

>probe:Drosophila_2:1629371_at:418:565; Interrogation_Position=119; Antisense; GGAATATTATCGCACTGCTTGCCCT
>probe:Drosophila_2:1629371_at:475:343; Interrogation_Position=135; Antisense; GCTTGCCCTCTATTTACTTATGGTG
>probe:Drosophila_2:1629371_at:293:121; Interrogation_Position=207; Antisense; AGCGGCAGCTATGTGGTGGTTTTAC
>probe:Drosophila_2:1629371_at:668:485; Interrogation_Position=253; Antisense; GTAGACACGGCATTCTTCATCTTGC
>probe:Drosophila_2:1629371_at:476:203; Interrogation_Position=289; Antisense; AACCAGCTGAGCTTCCTACATGTGT
>probe:Drosophila_2:1629371_at:376:129; Interrogation_Position=317; Antisense; ACCATAGCACCATGTTCTTGTTTTG
>probe:Drosophila_2:1629371_at:201:587; Interrogation_Position=343; Antisense; TGGACTTATGTCAAATGGCTGCCGA
>probe:Drosophila_2:1629371_at:626:527; Interrogation_Position=369; Antisense; GGGTTCAACCTTTTTTCCAAGCATG
>probe:Drosophila_2:1629371_at:529:455; Interrogation_Position=393; Antisense; GATAAACTCTTTTGTGCACGTGATT
>probe:Drosophila_2:1629371_at:543:593; Interrogation_Position=529; Antisense; TGGGCATCACAATTAGTTTTCCGGG
>probe:Drosophila_2:1629371_at:81:507; Interrogation_Position=601; Antisense; GTGCCATTTCTCTTTATGTTCGGTA
>probe:Drosophila_2:1629371_at:114:55; Interrogation_Position=616; Antisense; ATGTTCGGTAGGTTCTATGCTCAAA
>probe:Drosophila_2:1629371_at:242:135; Interrogation_Position=80; Antisense; ACGAACGGACGCAGGATTGGCCACT
>probe:Drosophila_2:1629371_at:449:3; Interrogation_Position=95; Antisense; ATTGGCCACTGGTCAAATCGCCGTG

Paste this into a BLAST search page for me
GGAATATTATCGCACTGCTTGCCCTGCTTGCCCTCTATTTACTTATGGTGAGCGGCAGCTATGTGGTGGTTTTACGTAGACACGGCATTCTTCATCTTGCAACCAGCTGAGCTTCCTACATGTGTACCATAGCACCATGTTCTTGTTTTGTGGACTTATGTCAAATGGCTGCCGAGGGTTCAACCTTTTTTCCAAGCATGGATAAACTCTTTTGTGCACGTGATTTGGGCATCACAATTAGTTTTCCGGGGTGCCATTTCTCTTTATGTTCGGTAATGTTCGGTAGGTTCTATGCTCAAAACGAACGGACGCAGGATTGGCCACTATTGGCCACTGGTCAAATCGCCGTG

Full Affymetrix probeset data:

Annotations for 1629371_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720