Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629373_at:

>probe:Drosophila_2:1629373_at:620:121; Interrogation_Position=1052; Antisense; AGCGGGTGCTGCAATCGCAGGCCAA
>probe:Drosophila_2:1629373_at:63:143; Interrogation_Position=1097; Antisense; ACTGGGACGCACTAGTGGACTACGT
>probe:Drosophila_2:1629373_at:677:555; Interrogation_Position=1113; Antisense; GGACTACGTATCCATGGCCTGGCAG
>probe:Drosophila_2:1629373_at:473:233; Interrogation_Position=1193; Antisense; AATGCTTCAAGCTGTTGGCGTGCTC
>probe:Drosophila_2:1629373_at:345:507; Interrogation_Position=1212; Antisense; GTGCTCCTGCTATGCGGCCATTAAG
>probe:Drosophila_2:1629373_at:512:233; Interrogation_Position=1245; Antisense; AATGCGATTGGGTCAGCTGCGACTC
>probe:Drosophila_2:1629373_at:359:119; Interrogation_Position=1259; Antisense; AGCTGCGACTCGAGACACTGGAACG
>probe:Drosophila_2:1629373_at:288:249; Interrogation_Position=1284; Antisense; CAATTTGCGCGAATGGTCCAAGGAC
>probe:Drosophila_2:1629373_at:43:617; Interrogation_Position=1340; Antisense; TGCAGCGTACGCTTAACAGCCGTAG
>probe:Drosophila_2:1629373_at:542:125; Interrogation_Position=1357; Antisense; AGCCGTAGCAGCTTGTAAACACTGT
>probe:Drosophila_2:1629373_at:140:69; Interrogation_Position=1400; Antisense; AGGCCGACTTGCTGAACTTGAGGTT
>probe:Drosophila_2:1629373_at:292:459; Interrogation_Position=1474; Antisense; GATATTTGGCGCAGCACGTGTTATA
>probe:Drosophila_2:1629373_at:120:243; Interrogation_Position=1510; Antisense; AATATGTTCCTCGACATGTTGTCCT
>probe:Drosophila_2:1629373_at:516:513; Interrogation_Position=1571; Antisense; GTGATCTAAGCCACACGCTAACTAA

Paste this into a BLAST search page for me
AGCGGGTGCTGCAATCGCAGGCCAAACTGGGACGCACTAGTGGACTACGTGGACTACGTATCCATGGCCTGGCAGAATGCTTCAAGCTGTTGGCGTGCTCGTGCTCCTGCTATGCGGCCATTAAGAATGCGATTGGGTCAGCTGCGACTCAGCTGCGACTCGAGACACTGGAACGCAATTTGCGCGAATGGTCCAAGGACTGCAGCGTACGCTTAACAGCCGTAGAGCCGTAGCAGCTTGTAAACACTGTAGGCCGACTTGCTGAACTTGAGGTTGATATTTGGCGCAGCACGTGTTATAAATATGTTCCTCGACATGTTGTCCTGTGATCTAAGCCACACGCTAACTAA

Full Affymetrix probeset data:

Annotations for 1629373_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime