FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629375_at:

>probe:Drosophila_2:1629375_at:482:641; Interrogation_Position=113; Antisense; TCTGGCTGTGTCTGTCATTGGATAC
>probe:Drosophila_2:1629375_at:447:165; Interrogation_Position=138; Antisense; AAATCGTGCAGCTCGAGTGCCCAGC
>probe:Drosophila_2:1629375_at:108:87; Interrogation_Position=153; Antisense; AGTGCCCAGCGATCAGTTTGTGTTT
>probe:Drosophila_2:1629375_at:591:475; Interrogation_Position=168; Antisense; GTTTGTGTTTCCCTCGGAGTCCAAG
>probe:Drosophila_2:1629375_at:208:167; Interrogation_Position=195; Antisense; AAATGCCACAGCCATCCGACTGGAA
>probe:Drosophila_2:1629375_at:45:607; Interrogation_Position=342; Antisense; TGAGTCACCGGCAAATACTACCAAT
>probe:Drosophila_2:1629375_at:706:197; Interrogation_Position=424; Antisense; AACGATGTGCCCAGCATTTCGAAAA
>probe:Drosophila_2:1629375_at:255:389; Interrogation_Position=444; Antisense; GAAAAATCATGCACATCCTTCCAGC
>probe:Drosophila_2:1629375_at:97:49; Interrogation_Position=458; Antisense; ATCCTTCCAGCGAGTCCAAGATGAT
>probe:Drosophila_2:1629375_at:691:651; Interrogation_Position=482; Antisense; TAACCTTCGGCCAGGAATCTAGTTC
>probe:Drosophila_2:1629375_at:678:31; Interrogation_Position=509; Antisense; ATAAGCCAGCGCCTTGGGATCATAC
>probe:Drosophila_2:1629375_at:388:379; Interrogation_Position=535; Antisense; GAAGCCACCAATGCTAGCAGTGCCA
>probe:Drosophila_2:1629375_at:492:199; Interrogation_Position=597; Antisense; AACGCGAATTTGTCCACAGGGCACT
>probe:Drosophila_2:1629375_at:268:81; Interrogation_Position=614; Antisense; AGGGCACTACTCTGACCGTAAATGA

Paste this into a BLAST search page for me
TCTGGCTGTGTCTGTCATTGGATACAAATCGTGCAGCTCGAGTGCCCAGCAGTGCCCAGCGATCAGTTTGTGTTTGTTTGTGTTTCCCTCGGAGTCCAAGAAATGCCACAGCCATCCGACTGGAATGAGTCACCGGCAAATACTACCAATAACGATGTGCCCAGCATTTCGAAAAGAAAAATCATGCACATCCTTCCAGCATCCTTCCAGCGAGTCCAAGATGATTAACCTTCGGCCAGGAATCTAGTTCATAAGCCAGCGCCTTGGGATCATACGAAGCCACCAATGCTAGCAGTGCCAAACGCGAATTTGTCCACAGGGCACTAGGGCACTACTCTGACCGTAAATGA

Full Affymetrix probeset data:

Annotations for 1629375_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720