FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629377_at:

>probe:Drosophila_2:1629377_at:661:391; Interrogation_Position=125; Antisense; GAAAGTACCTGTTGCTGACGAATAC
>probe:Drosophila_2:1629377_at:90:365; Interrogation_Position=144; Antisense; GAATACCATCGGATCGGGACTGCTC
>probe:Drosophila_2:1629377_at:238:211; Interrogation_Position=217; Antisense; AAGAAAGCCTTTGACTACTCTCGCT
>probe:Drosophila_2:1629377_at:371:665; Interrogation_Position=232; Antisense; TACTCTCGCTCAGGATGCATGATGA
>probe:Drosophila_2:1629377_at:212:605; Interrogation_Position=269; Antisense; TGATTGGTCCGATTCAGCACGGCTT
>probe:Drosophila_2:1629377_at:476:141; Interrogation_Position=287; Antisense; ACGGCTTCTATCTGCTGTTGGATGG
>probe:Drosophila_2:1629377_at:465:269; Interrogation_Position=372; Antisense; CATGTCACCCATCTATATATTCCTG
>probe:Drosophila_2:1629377_at:520:503; Interrogation_Position=456; Antisense; GTCCGAGAAGTTCCTCTACACATGG
>probe:Drosophila_2:1629377_at:525:257; Interrogation_Position=474; Antisense; CACATGGATGTTGGACTGCTGCTTT
>probe:Drosophila_2:1629377_at:460:499; Interrogation_Position=506; Antisense; GTCTGCAATATCTTAACTTCCGCTT
>probe:Drosophila_2:1629377_at:493:329; Interrogation_Position=548; Antisense; GCGTGGTGTTCGTCAATGTAGCCAA
>probe:Drosophila_2:1629377_at:543:487; Interrogation_Position=565; Antisense; GTAGCCAATTGCGTGTACGTCGTTC
>probe:Drosophila_2:1629377_at:330:671; Interrogation_Position=580; Antisense; TACGTCGTTCTGCTTTCTCATATAA
>probe:Drosophila_2:1629377_at:108:475; Interrogation_Position=63; Antisense; GTTAGTAACGCATTTCTCGACAGCC

Paste this into a BLAST search page for me
GAAAGTACCTGTTGCTGACGAATACGAATACCATCGGATCGGGACTGCTCAAGAAAGCCTTTGACTACTCTCGCTTACTCTCGCTCAGGATGCATGATGATGATTGGTCCGATTCAGCACGGCTTACGGCTTCTATCTGCTGTTGGATGGCATGTCACCCATCTATATATTCCTGGTCCGAGAAGTTCCTCTACACATGGCACATGGATGTTGGACTGCTGCTTTGTCTGCAATATCTTAACTTCCGCTTGCGTGGTGTTCGTCAATGTAGCCAAGTAGCCAATTGCGTGTACGTCGTTCTACGTCGTTCTGCTTTCTCATATAAGTTAGTAACGCATTTCTCGACAGCC

Full Affymetrix probeset data:

Annotations for 1629377_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720