Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629378_at:

>probe:Drosophila_2:1629378_at:51:729; Interrogation_Position=1128; Antisense; TTGGTGATGCACTGACGGTAAACGA
>probe:Drosophila_2:1629378_at:94:645; Interrogation_Position=1229; Antisense; TCTACCGAAGATTTGGATGCCGCTC
>probe:Drosophila_2:1629378_at:222:547; Interrogation_Position=1243; Antisense; GGATGCCGCTCCTAATGTGAAACAG
>probe:Drosophila_2:1629378_at:232:179; Interrogation_Position=1263; Antisense; AACAGACCTTTTATACTTCGGCAGT
>probe:Drosophila_2:1629378_at:703:687; Interrogation_Position=1303; Antisense; TTTGCTTGCTAAAAACCATTCCGTT
>probe:Drosophila_2:1629378_at:511:305; Interrogation_Position=1318; Antisense; CCATTCCGTTTTTGATTCCGATTTG
>probe:Drosophila_2:1629378_at:160:463; Interrogation_Position=1343; Antisense; GATTCTTCTGAATCCTCCTCTACAA
>probe:Drosophila_2:1629378_at:285:643; Interrogation_Position=1448; Antisense; TCTAACGCAAGTTCTTTCTCGGACT
>probe:Drosophila_2:1629378_at:161:259; Interrogation_Position=1477; Antisense; CACATGTTCTGGTGGTGATTCCGAA
>probe:Drosophila_2:1629378_at:529:631; Interrogation_Position=1508; Antisense; TCCGTTCAAGATTCCAATGTAGCGT
>probe:Drosophila_2:1629378_at:287:329; Interrogation_Position=1529; Antisense; GCGTGTACACCAAATTTGACTCCAG
>probe:Drosophila_2:1629378_at:487:125; Interrogation_Position=1566; Antisense; AGCCCGCCACGAATTCTGCAGAATA
>probe:Drosophila_2:1629378_at:669:687; Interrogation_Position=1589; Antisense; TATTCCGGTACAGTTTCTTCGACTT
>probe:Drosophila_2:1629378_at:299:641; Interrogation_Position=1604; Antisense; TCTTCGACTTATTCCCAAACCGATA

Paste this into a BLAST search page for me
TTGGTGATGCACTGACGGTAAACGATCTACCGAAGATTTGGATGCCGCTCGGATGCCGCTCCTAATGTGAAACAGAACAGACCTTTTATACTTCGGCAGTTTTGCTTGCTAAAAACCATTCCGTTCCATTCCGTTTTTGATTCCGATTTGGATTCTTCTGAATCCTCCTCTACAATCTAACGCAAGTTCTTTCTCGGACTCACATGTTCTGGTGGTGATTCCGAATCCGTTCAAGATTCCAATGTAGCGTGCGTGTACACCAAATTTGACTCCAGAGCCCGCCACGAATTCTGCAGAATATATTCCGGTACAGTTTCTTCGACTTTCTTCGACTTATTCCCAAACCGATA

Full Affymetrix probeset data:

Annotations for 1629378_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime