FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629380_at:

>probe:Drosophila_2:1629380_at:397:293; Interrogation_Position=117; Antisense; CGATGTGGTTAAGGCCGCTGAGACC
>probe:Drosophila_2:1629380_at:536:607; Interrogation_Position=135; Antisense; TGAGACCGCCGAGGCTCAGGCTTCT
>probe:Drosophila_2:1629380_at:215:587; Interrogation_Position=203; Antisense; TGGACGGTGCTGACTGGAATTCCCT
>probe:Drosophila_2:1629380_at:476:563; Interrogation_Position=218; Antisense; GGAATTCCCTCAACCGTTATGGATG
>probe:Drosophila_2:1629380_at:403:63; Interrogation_Position=240; Antisense; ATGGGAGCAGGGTCGCCCACTTTTG
>probe:Drosophila_2:1629380_at:52:671; Interrogation_Position=26; Antisense; TACGTCTTCTCTGCCTGATGGCCTG
>probe:Drosophila_2:1629380_at:570:133; Interrogation_Position=315; Antisense; ACGCTCCTTCGTGGCTGAGGTCGAT
>probe:Drosophila_2:1629380_at:265:435; Interrogation_Position=331; Antisense; GAGGTCGATCCAGTCTTCAAGAAGA
>probe:Drosophila_2:1629380_at:622:209; Interrogation_Position=349; Antisense; AAGAAGAGCCAATACGGCGGATCTT
>probe:Drosophila_2:1629380_at:524:29; Interrogation_Position=360; Antisense; ATACGGCGGATCTTACGGCGAGAAT
>probe:Drosophila_2:1629380_at:261:289; Interrogation_Position=375; Antisense; CGGCGAGAATGCGTACCTGAAGACC
>probe:Drosophila_2:1629380_at:207:369; Interrogation_Position=393; Antisense; GAAGACCGACGCCAAACTGGGTGTT
>probe:Drosophila_2:1629380_at:67:257; Interrogation_Position=405; Antisense; CAAACTGGGTGTTGTGGCCATCTAA
>probe:Drosophila_2:1629380_at:153:243; Interrogation_Position=81; Antisense; CAACTACGGCGGATCCGGATACGGA

Paste this into a BLAST search page for me
CGATGTGGTTAAGGCCGCTGAGACCTGAGACCGCCGAGGCTCAGGCTTCTTGGACGGTGCTGACTGGAATTCCCTGGAATTCCCTCAACCGTTATGGATGATGGGAGCAGGGTCGCCCACTTTTGTACGTCTTCTCTGCCTGATGGCCTGACGCTCCTTCGTGGCTGAGGTCGATGAGGTCGATCCAGTCTTCAAGAAGAAAGAAGAGCCAATACGGCGGATCTTATACGGCGGATCTTACGGCGAGAATCGGCGAGAATGCGTACCTGAAGACCGAAGACCGACGCCAAACTGGGTGTTCAAACTGGGTGTTGTGGCCATCTAACAACTACGGCGGATCCGGATACGGA

Full Affymetrix probeset data:

Annotations for 1629380_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720