Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629382_at:

>probe:Drosophila_2:1629382_at:71:165; Interrogation_Position=1345; Antisense; AAATCCGCAAGGGAGTTAGCTTTCT
>probe:Drosophila_2:1629382_at:414:527; Interrogation_Position=1355; Antisense; GGGAGTTAGCTTTCTTTGGCAATAA
>probe:Drosophila_2:1629382_at:215:109; Interrogation_Position=1385; Antisense; AGAAGCGTCCAATTACCCGATGTGT
>probe:Drosophila_2:1629382_at:391:133; Interrogation_Position=1399; Antisense; ACCCGATGTGTAAGCCCGACGATAG
>probe:Drosophila_2:1629382_at:699:303; Interrogation_Position=1414; Antisense; CCGACGATAGTCAACAAGTGCTTTA
>probe:Drosophila_2:1629382_at:104:431; Interrogation_Position=1444; Antisense; GAGTAGAAACATCCACCAGAGAATA
>probe:Drosophila_2:1629382_at:447:59; Interrogation_Position=1496; Antisense; ATGTTATTGTTTCCATTCGCTTCGT
>probe:Drosophila_2:1629382_at:390:491; Interrogation_Position=1558; Antisense; GTACAAATACTCCAACGGTTGCGTT
>probe:Drosophila_2:1629382_at:104:141; Interrogation_Position=1572; Antisense; ACGGTTGCGTTCGTAGTGCGGCCAT
>probe:Drosophila_2:1629382_at:185:509; Interrogation_Position=1587; Antisense; GTGCGGCCATTCTTATTGCCATTTA
>probe:Drosophila_2:1629382_at:453:667; Interrogation_Position=1610; Antisense; TACATTTTGTTATCCAGCATAGTCG
>probe:Drosophila_2:1629382_at:212:683; Interrogation_Position=1620; Antisense; TATCCAGCATAGTCGTTGAGTTTTT
>probe:Drosophila_2:1629382_at:637:151; Interrogation_Position=1821; Antisense; ACATCACAATTCAAACTCAGGTCTT
>probe:Drosophila_2:1629382_at:475:603; Interrogation_Position=1902; Antisense; TGATAACCGCTTTGAAATATACACA

Paste this into a BLAST search page for me
AAATCCGCAAGGGAGTTAGCTTTCTGGGAGTTAGCTTTCTTTGGCAATAAAGAAGCGTCCAATTACCCGATGTGTACCCGATGTGTAAGCCCGACGATAGCCGACGATAGTCAACAAGTGCTTTAGAGTAGAAACATCCACCAGAGAATAATGTTATTGTTTCCATTCGCTTCGTGTACAAATACTCCAACGGTTGCGTTACGGTTGCGTTCGTAGTGCGGCCATGTGCGGCCATTCTTATTGCCATTTATACATTTTGTTATCCAGCATAGTCGTATCCAGCATAGTCGTTGAGTTTTTACATCACAATTCAAACTCAGGTCTTTGATAACCGCTTTGAAATATACACA

Full Affymetrix probeset data:

Annotations for 1629382_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime