Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629383_a_at:

>probe:Drosophila_2:1629383_a_at:577:629; Interrogation_Position=286; Antisense; TCCTGCCCGGCGCCAAAGTGAAGAA
>probe:Drosophila_2:1629383_a_at:414:83; Interrogation_Position=302; Antisense; AGTGAAGAAGGATGCGCCCACGACA
>probe:Drosophila_2:1629383_a_at:26:79; Interrogation_Position=310; Antisense; AGGATGCGCCCACGACAGAGTCCTA
>probe:Drosophila_2:1629383_a_at:372:427; Interrogation_Position=327; Antisense; GAGTCCTACTTGAGGCACTACCCCA
>probe:Drosophila_2:1629383_a_at:255:269; Interrogation_Position=373; Antisense; CAGGACACGACTACCATGACAGTAT
>probe:Drosophila_2:1629383_a_at:284:55; Interrogation_Position=399; Antisense; ATGAAGCAGCGCGTGGCCGACACCA
>probe:Drosophila_2:1629383_a_at:331:581; Interrogation_Position=412; Antisense; TGGCCGACACCATGCTGCACAAGGT
>probe:Drosophila_2:1629383_a_at:713:269; Interrogation_Position=422; Antisense; CATGCTGCACAAGGTGGTCGGTTCG
>probe:Drosophila_2:1629383_a_at:573:471; Interrogation_Position=442; Antisense; GTTCGGAAGCCGACACTGGCCGCGT
>probe:Drosophila_2:1629383_a_at:568:495; Interrogation_Position=465; Antisense; GTCTTCCACAAGCAATTCAACTCGC
>probe:Drosophila_2:1629383_a_at:275:13; Interrogation_Position=479; Antisense; ATTCAACTCGCCCATTGGCCTGTAC
>probe:Drosophila_2:1629383_a_at:209:3; Interrogation_Position=492; Antisense; ATTGGCCTGTACTCCAACAACAACA
>probe:Drosophila_2:1629383_a_at:270:187; Interrogation_Position=510; Antisense; AACAACATCGAGGACACCATCAGAT
>probe:Drosophila_2:1629383_a_at:248:437; Interrogation_Position=519; Antisense; GAGGACACCATCAGATCCACAGTTC

Paste this into a BLAST search page for me
TCCTGCCCGGCGCCAAAGTGAAGAAAGTGAAGAAGGATGCGCCCACGACAAGGATGCGCCCACGACAGAGTCCTAGAGTCCTACTTGAGGCACTACCCCACAGGACACGACTACCATGACAGTATATGAAGCAGCGCGTGGCCGACACCATGGCCGACACCATGCTGCACAAGGTCATGCTGCACAAGGTGGTCGGTTCGGTTCGGAAGCCGACACTGGCCGCGTGTCTTCCACAAGCAATTCAACTCGCATTCAACTCGCCCATTGGCCTGTACATTGGCCTGTACTCCAACAACAACAAACAACATCGAGGACACCATCAGATGAGGACACCATCAGATCCACAGTTC

Full Affymetrix probeset data:

Annotations for 1629383_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime