FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629384_at:

>probe:Drosophila_2:1629384_at:528:473; Interrogation_Position=2213; Antisense; GTTATCGACAGCATACCCAATTCTC
>probe:Drosophila_2:1629384_at:466:41; Interrogation_Position=2262; Antisense; ATCGGAGAGAAACGCGAGCCGCCTC
>probe:Drosophila_2:1629384_at:340:211; Interrogation_Position=2288; Antisense; AAGAAGCTCTTCCTGTCCATTTATG
>probe:Drosophila_2:1629384_at:423:15; Interrogation_Position=2306; Antisense; ATTTATGCCATGTTGCTGGACAGCA
>probe:Drosophila_2:1629384_at:245:123; Interrogation_Position=2376; Antisense; AGCGACATGCGGATCTATGCCTACG
>probe:Drosophila_2:1629384_at:10:653; Interrogation_Position=2421; Antisense; TCAAGCGGAACATCGACTCGGGATT
>probe:Drosophila_2:1629384_at:432:405; Interrogation_Position=2435; Antisense; GACTCGGGATTCATTCGCAGCTTGA
>probe:Drosophila_2:1629384_at:630:609; Interrogation_Position=2457; Antisense; TGAGCGAGCTGCACAGGGATGTCCT
>probe:Drosophila_2:1629384_at:254:619; Interrogation_Position=2481; Antisense; TGCTCATGGCCCACAACGTTTTGGT
>probe:Drosophila_2:1629384_at:29:179; Interrogation_Position=2535; Antisense; AAACGGCGCGTTTGTTCGTGCAGGA
>probe:Drosophila_2:1629384_at:482:639; Interrogation_Position=2550; Antisense; TCGTGCAGGACTGTCAGGCGATCAA
>probe:Drosophila_2:1629384_at:655:169; Interrogation_Position=2573; Antisense; AAAGAGTTCTCCCAATTGCCGGACG
>probe:Drosophila_2:1629384_at:705:311; Interrogation_Position=2694; Antisense; GCCAAAGGCATCACTAGGCTCACTT
>probe:Drosophila_2:1629384_at:671:571; Interrogation_Position=2710; Antisense; GGCTCACTTAACTTTTCACACGTAT

Paste this into a BLAST search page for me
GTTATCGACAGCATACCCAATTCTCATCGGAGAGAAACGCGAGCCGCCTCAAGAAGCTCTTCCTGTCCATTTATGATTTATGCCATGTTGCTGGACAGCAAGCGACATGCGGATCTATGCCTACGTCAAGCGGAACATCGACTCGGGATTGACTCGGGATTCATTCGCAGCTTGATGAGCGAGCTGCACAGGGATGTCCTTGCTCATGGCCCACAACGTTTTGGTAAACGGCGCGTTTGTTCGTGCAGGATCGTGCAGGACTGTCAGGCGATCAAAAAGAGTTCTCCCAATTGCCGGACGGCCAAAGGCATCACTAGGCTCACTTGGCTCACTTAACTTTTCACACGTAT

Full Affymetrix probeset data:

Annotations for 1629384_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720