Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629388_s_at:

>probe:Drosophila_2:1629388_s_at:260:213; Interrogation_Position=1008; Antisense; AAGAGCTAGGTGTGACTTCGTACAA
>probe:Drosophila_2:1629388_s_at:368:727; Interrogation_Position=1045; Antisense; TTGTCATTAACTTCAATCCATCCCC
>probe:Drosophila_2:1629388_s_at:434:147; Interrogation_Position=1072; Antisense; ACTATCGATCGTGACTGGGAAACAT
>probe:Drosophila_2:1629388_s_at:516:95; Interrogation_Position=647; Antisense; AGATCAACTGGAGTTGTCCCTGCCT
>probe:Drosophila_2:1629388_s_at:384:595; Interrogation_Position=694; Antisense; TGTGGCGTCGATTTCCGTGAGGCAT
>probe:Drosophila_2:1629388_s_at:487:345; Interrogation_Position=715; Antisense; GCATTTTCCTGCTTCCAGAACAGCA
>probe:Drosophila_2:1629388_s_at:491:45; Interrogation_Position=746; Antisense; ATCCCAAGGGATCGGACTGCTACGA
>probe:Drosophila_2:1629388_s_at:69:49; Interrogation_Position=770; Antisense; ATGCCTTCACCAAGATGCGCGACTG
>probe:Drosophila_2:1629388_s_at:419:49; Interrogation_Position=784; Antisense; ATGCGCGACTGTTTCCAGAAGTACC
>probe:Drosophila_2:1629388_s_at:345:673; Interrogation_Position=805; Antisense; TACCCCACCGTGTACAACAAATCTG
>probe:Drosophila_2:1629388_s_at:173:67; Interrogation_Position=851; Antisense; ATGGCTTGAGCGAGGCCTTGGACAC
>probe:Drosophila_2:1629388_s_at:425:729; Interrogation_Position=890; Antisense; TTGGTGGCCAGAACGCGGATCCGCT
>probe:Drosophila_2:1629388_s_at:43:633; Interrogation_Position=909; Antisense; TCCGCTGGCGGATGTGGGCAACAAC
>probe:Drosophila_2:1629388_s_at:462:675; Interrogation_Position=963; Antisense; TAGCAGTTCAGTGGTGCCCAAGGCT

Paste this into a BLAST search page for me
AAGAGCTAGGTGTGACTTCGTACAATTGTCATTAACTTCAATCCATCCCCACTATCGATCGTGACTGGGAAACATAGATCAACTGGAGTTGTCCCTGCCTTGTGGCGTCGATTTCCGTGAGGCATGCATTTTCCTGCTTCCAGAACAGCAATCCCAAGGGATCGGACTGCTACGAATGCCTTCACCAAGATGCGCGACTGATGCGCGACTGTTTCCAGAAGTACCTACCCCACCGTGTACAACAAATCTGATGGCTTGAGCGAGGCCTTGGACACTTGGTGGCCAGAACGCGGATCCGCTTCCGCTGGCGGATGTGGGCAACAACTAGCAGTTCAGTGGTGCCCAAGGCT

Full Affymetrix probeset data:

Annotations for 1629388_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime