FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629391_at:

>probe:Drosophila_2:1629391_at:503:307; Interrogation_Position=1036; Antisense; CCAAACGGGCGGACCAATGGACATT
>probe:Drosophila_2:1629391_at:471:127; Interrogation_Position=1048; Antisense; ACCAATGGACATTTAGGGAACCGAG
>probe:Drosophila_2:1629391_at:83:293; Interrogation_Position=1069; Antisense; CGAGGAATATTTGAGCTTTCACCAA
>probe:Drosophila_2:1629391_at:649:201; Interrogation_Position=519; Antisense; AACCAGATGAAGTGCGCCGTTCCCG
>probe:Drosophila_2:1629391_at:351:389; Interrogation_Position=566; Antisense; GAAACACAGCCACGAGCACTTGCAT
>probe:Drosophila_2:1629391_at:111:131; Interrogation_Position=601; Antisense; ACGACGCGGGCCAGAAGGATAAGCA
>probe:Drosophila_2:1629391_at:481:595; Interrogation_Position=650; Antisense; TGTGGAGAGCGATTCACGGCCAGCT
>probe:Drosophila_2:1629391_at:444:649; Interrogation_Position=663; Antisense; TCACGGCCAGCTGACAATTCGAATT
>probe:Drosophila_2:1629391_at:455:141; Interrogation_Position=759; Antisense; ACGGAGCCCGTGTTCGAGAATGGCA
>probe:Drosophila_2:1629391_at:579:227; Interrogation_Position=777; Antisense; AATGGCATGGAAAACGCCGCGGAAC
>probe:Drosophila_2:1629391_at:509:381; Interrogation_Position=798; Antisense; GAACCCATTGCCGAGCAGGAGCAAA
>probe:Drosophila_2:1629391_at:460:295; Interrogation_Position=809; Antisense; CGAGCAGGAGCAAACGGTGCCGCCA
>probe:Drosophila_2:1629391_at:367:131; Interrogation_Position=848; Antisense; ACCCGCGGCGGCAGACGCAACTGGA
>probe:Drosophila_2:1629391_at:396:113; Interrogation_Position=977; Antisense; AGCAGCTCCCGAGGGCGAAGCAACA

Paste this into a BLAST search page for me
CCAAACGGGCGGACCAATGGACATTACCAATGGACATTTAGGGAACCGAGCGAGGAATATTTGAGCTTTCACCAAAACCAGATGAAGTGCGCCGTTCCCGGAAACACAGCCACGAGCACTTGCATACGACGCGGGCCAGAAGGATAAGCATGTGGAGAGCGATTCACGGCCAGCTTCACGGCCAGCTGACAATTCGAATTACGGAGCCCGTGTTCGAGAATGGCAAATGGCATGGAAAACGCCGCGGAACGAACCCATTGCCGAGCAGGAGCAAACGAGCAGGAGCAAACGGTGCCGCCAACCCGCGGCGGCAGACGCAACTGGAAGCAGCTCCCGAGGGCGAAGCAACA

Full Affymetrix probeset data:

Annotations for 1629391_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720