FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629394_at:

>probe:Drosophila_2:1629394_at:594:605; Interrogation_Position=101; Antisense; TGATCAAGATCACCCTCATCTGCTG
>probe:Drosophila_2:1629394_at:705:565; Interrogation_Position=15; Antisense; GGCAATCCAAGACAGTTCCGACAGC
>probe:Drosophila_2:1629394_at:529:119; Interrogation_Position=162; Antisense; AGCTGCTGTTCCAGTGGGAGTGCCC
>probe:Drosophila_2:1629394_at:295:85; Interrogation_Position=180; Antisense; AGTGCCCCTCAACACGGAGGTGGAT
>probe:Drosophila_2:1629394_at:723:519; Interrogation_Position=199; Antisense; GTGGATCCACATCCGCAGTACGCGT
>probe:Drosophila_2:1629394_at:142:489; Interrogation_Position=216; Antisense; GTACGCGTTCGCCTATAATGTGCAG
>probe:Drosophila_2:1629394_at:521:655; Interrogation_Position=231; Antisense; TAATGTGCAGGATGCCCTTACCGGG
>probe:Drosophila_2:1629394_at:719:219; Interrogation_Position=298; Antisense; AAGGGCTCCTACTCGGTGGTCGATG
>probe:Drosophila_2:1629394_at:554:501; Interrogation_Position=316; Antisense; GTCGATGCCGATGGTTCACTGCGCA
>probe:Drosophila_2:1629394_at:156:729; Interrogation_Position=41; Antisense; TTGTCAAGCACAAAGCACCATTGGA
>probe:Drosophila_2:1629394_at:323:5; Interrogation_Position=420; Antisense; ATTGGTGGCTCCAGTGGCTGCTCCA
>probe:Drosophila_2:1629394_at:576:83; Interrogation_Position=432; Antisense; AGTGGCTGCTCCAATCTTGGGCTAA
>probe:Drosophila_2:1629394_at:284:561; Interrogation_Position=63; Antisense; GGAAAACCACTATCCACCAGCAAAT
>probe:Drosophila_2:1629394_at:633:111; Interrogation_Position=81; Antisense; AGCAAATCTAGTCATGGCCCTGATC

Paste this into a BLAST search page for me
TGATCAAGATCACCCTCATCTGCTGGGCAATCCAAGACAGTTCCGACAGCAGCTGCTGTTCCAGTGGGAGTGCCCAGTGCCCCTCAACACGGAGGTGGATGTGGATCCACATCCGCAGTACGCGTGTACGCGTTCGCCTATAATGTGCAGTAATGTGCAGGATGCCCTTACCGGGAAGGGCTCCTACTCGGTGGTCGATGGTCGATGCCGATGGTTCACTGCGCATTGTCAAGCACAAAGCACCATTGGAATTGGTGGCTCCAGTGGCTGCTCCAAGTGGCTGCTCCAATCTTGGGCTAAGGAAAACCACTATCCACCAGCAAATAGCAAATCTAGTCATGGCCCTGATC

Full Affymetrix probeset data:

Annotations for 1629394_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720