FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629398_at:

>probe:Drosophila_2:1629398_at:477:675; Interrogation_Position=2325; Antisense; TAGCTGAAGGATCCCCTACCATGTT
>probe:Drosophila_2:1629398_at:478:673; Interrogation_Position=2341; Antisense; TACCATGTTGACCTCGTTCAAGTTC
>probe:Drosophila_2:1629398_at:20:345; Interrogation_Position=2373; Antisense; GCATTGTCACCGAAGAGTCCTCTAA
>probe:Drosophila_2:1629398_at:681:443; Interrogation_Position=2429; Antisense; GATGATCACTTGAGTCTCTCCAAGC
>probe:Drosophila_2:1629398_at:340:125; Interrogation_Position=2451; Antisense; AGCCCATTTACAGGCAATCGTTTCT
>probe:Drosophila_2:1629398_at:390:461; Interrogation_Position=2484; Antisense; GATTATTGCACGTGATCCGCGAGGC
>probe:Drosophila_2:1629398_at:420:547; Interrogation_Position=2539; Antisense; GGATGGCCAGTCACAAAGCACTTCG
>probe:Drosophila_2:1629398_at:213:727; Interrogation_Position=2580; Antisense; TTGTCAAGATCGTAGCTGCTCTGTT
>probe:Drosophila_2:1629398_at:21:81; Interrogation_Position=2607; Antisense; AGGGAGCCAAGGGTCTGTTCGAATC
>probe:Drosophila_2:1629398_at:19:89; Interrogation_Position=2641; Antisense; AGTCGCCCTCAGATTTAGCACTTAG
>probe:Drosophila_2:1629398_at:4:489; Interrogation_Position=2692; Antisense; GTACCCTAATAGTATCCCGACTAGT
>probe:Drosophila_2:1629398_at:225:649; Interrogation_Position=2753; Antisense; TCACCATCATGACCATTCATCTTTG
>probe:Drosophila_2:1629398_at:608:725; Interrogation_Position=2775; Antisense; TTGTAAATACTCCAGCACTCCATAT
>probe:Drosophila_2:1629398_at:147:655; Interrogation_Position=2820; Antisense; TAACTTATTATTCTCGGTCTCCGAC

Paste this into a BLAST search page for me
TAGCTGAAGGATCCCCTACCATGTTTACCATGTTGACCTCGTTCAAGTTCGCATTGTCACCGAAGAGTCCTCTAAGATGATCACTTGAGTCTCTCCAAGCAGCCCATTTACAGGCAATCGTTTCTGATTATTGCACGTGATCCGCGAGGCGGATGGCCAGTCACAAAGCACTTCGTTGTCAAGATCGTAGCTGCTCTGTTAGGGAGCCAAGGGTCTGTTCGAATCAGTCGCCCTCAGATTTAGCACTTAGGTACCCTAATAGTATCCCGACTAGTTCACCATCATGACCATTCATCTTTGTTGTAAATACTCCAGCACTCCATATTAACTTATTATTCTCGGTCTCCGAC

Full Affymetrix probeset data:

Annotations for 1629398_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720