FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629400_at:

>probe:Drosophila_2:1629400_at:198:711; Interrogation_Position=173; Antisense; TTCAGCGCCGCACCAACAAGAAGTT
>probe:Drosophila_2:1629400_at:283:251; Interrogation_Position=189; Antisense; CAAGAAGTTCAACCGCATCATCCTG
>probe:Drosophila_2:1629400_at:569:345; Interrogation_Position=203; Antisense; GCATCATCCTGAAGCGTTTGTTCAT
>probe:Drosophila_2:1629400_at:365:57; Interrogation_Position=226; Antisense; ATGAGCAAGATCAACAGGCCGCCGC
>probe:Drosophila_2:1629400_at:700:429; Interrogation_Position=298; Antisense; GAGTCTACCATCGTGGTCGTCGGCA
>probe:Drosophila_2:1629400_at:293:435; Interrogation_Position=424; Antisense; GAGGTCCTGACCTTCGATCAACTGG
>probe:Drosophila_2:1629400_at:552:211; Interrogation_Position=469; Antisense; AAGAACACGCTGCTGCTGCAGGGCA
>probe:Drosophila_2:1629400_at:225:209; Interrogation_Position=517; Antisense; AAGCACTTCGGCAAGGCTCCCGGTG
>probe:Drosophila_2:1629400_at:648:61; Interrogation_Position=566; Antisense; ATGTCCGCTCTAAGGGACGCAAGTT
>probe:Drosophila_2:1629400_at:107:253; Interrogation_Position=585; Antisense; CAAGTTCGAGCGTGCTCGTGGTCGT
>probe:Drosophila_2:1629400_at:548:205; Interrogation_Position=635; Antisense; AAGCGACTGGCTGACTGGACTGGAT
>probe:Drosophila_2:1629400_at:373:573; Interrogation_Position=643; Antisense; GGCTGACTGGACTGGATTCGGCATC
>probe:Drosophila_2:1629400_at:428:717; Interrogation_Position=659; Antisense; TTCGGCATCCTTTTGGTTAAGATAA
>probe:Drosophila_2:1629400_at:415:455; Interrogation_Position=679; Antisense; GATAATGATTTTTCTCGCCATCGCA

Paste this into a BLAST search page for me
TTCAGCGCCGCACCAACAAGAAGTTCAAGAAGTTCAACCGCATCATCCTGGCATCATCCTGAAGCGTTTGTTCATATGAGCAAGATCAACAGGCCGCCGCGAGTCTACCATCGTGGTCGTCGGCAGAGGTCCTGACCTTCGATCAACTGGAAGAACACGCTGCTGCTGCAGGGCAAAGCACTTCGGCAAGGCTCCCGGTGATGTCCGCTCTAAGGGACGCAAGTTCAAGTTCGAGCGTGCTCGTGGTCGTAAGCGACTGGCTGACTGGACTGGATGGCTGACTGGACTGGATTCGGCATCTTCGGCATCCTTTTGGTTAAGATAAGATAATGATTTTTCTCGCCATCGCA

Full Affymetrix probeset data:

Annotations for 1629400_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720