FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629402_at:

>probe:Drosophila_2:1629402_at:536:345; Interrogation_Position=1313; Antisense; GCATTTGCAAGAAAGCCACCACCGA
>probe:Drosophila_2:1629402_at:678:203; Interrogation_Position=1325; Antisense; AAGCCACCACCGACAGGGAGGTAGA
>probe:Drosophila_2:1629402_at:321:485; Interrogation_Position=1345; Antisense; GTAGAACTTGATGAGCTGCACACCG
>probe:Drosophila_2:1629402_at:438:335; Interrogation_Position=1359; Antisense; GCTGCACACCGATATCTATGCCAAG
>probe:Drosophila_2:1629402_at:729:329; Interrogation_Position=1406; Antisense; GCGTGTCCGGATTCCATTTAGAGCA
>probe:Drosophila_2:1629402_at:43:205; Interrogation_Position=1459; Antisense; AAGCCGAAGAAGACGCCGGCCAGCG
>probe:Drosophila_2:1629402_at:89:97; Interrogation_Position=1484; Antisense; AGATCAACGACGTGCCAGTGGGCGC
>probe:Drosophila_2:1629402_at:503:209; Interrogation_Position=1597; Antisense; AAGAAGGGCGCCGACGCCAAGCAGC
>probe:Drosophila_2:1629402_at:268:659; Interrogation_Position=1647; Antisense; TAAGAAGCCAAAACCAGCCGCACAG
>probe:Drosophila_2:1629402_at:582:203; Interrogation_Position=1688; Antisense; CACCCGCTCCCAAAAAGTAGTATGC
>probe:Drosophila_2:1629402_at:568:561; Interrogation_Position=1724; Antisense; GGAACACCATCGTTAGCTTTTCAGC
>probe:Drosophila_2:1629402_at:36:391; Interrogation_Position=1754; Antisense; GAAAGTTTCGCCAGAGTGCTTTAGC
>probe:Drosophila_2:1629402_at:260:509; Interrogation_Position=1769; Antisense; GTGCTTTAGCTGGTTTCTGAACCCA
>probe:Drosophila_2:1629402_at:658:663; Interrogation_Position=1824; Antisense; TACAGTATGATTCCGTTTTGAGTTG

Paste this into a BLAST search page for me
GCATTTGCAAGAAAGCCACCACCGAAAGCCACCACCGACAGGGAGGTAGAGTAGAACTTGATGAGCTGCACACCGGCTGCACACCGATATCTATGCCAAGGCGTGTCCGGATTCCATTTAGAGCAAAGCCGAAGAAGACGCCGGCCAGCGAGATCAACGACGTGCCAGTGGGCGCAAGAAGGGCGCCGACGCCAAGCAGCTAAGAAGCCAAAACCAGCCGCACAGCACCCGCTCCCAAAAAGTAGTATGCGGAACACCATCGTTAGCTTTTCAGCGAAAGTTTCGCCAGAGTGCTTTAGCGTGCTTTAGCTGGTTTCTGAACCCATACAGTATGATTCCGTTTTGAGTTG

Full Affymetrix probeset data:

Annotations for 1629402_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720