Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629406_at:

>probe:Drosophila_2:1629406_at:78:179; Interrogation_Position=1047; Antisense; AAACACGCATCTTCGAGTCACAAGG
>probe:Drosophila_2:1629406_at:32:641; Interrogation_Position=532; Antisense; TCGGCCAACGGAGATGCAGCTGCGC
>probe:Drosophila_2:1629406_at:229:563; Interrogation_Position=565; Antisense; GGCAACAATCCCCATTCGAGGAACT
>probe:Drosophila_2:1629406_at:425:299; Interrogation_Position=696; Antisense; CGCCATCCTAAGTCGCAGGCAGAAG
>probe:Drosophila_2:1629406_at:586:559; Interrogation_Position=733; Antisense; GGAAAGAATACTGCCGCCTACGAGC
>probe:Drosophila_2:1629406_at:138:225; Interrogation_Position=778; Antisense; AAGGACGAGCGGACTCGCGATCATC
>probe:Drosophila_2:1629406_at:652:299; Interrogation_Position=803; Antisense; CGCGCACCCCGAACAAGTATGGAAA
>probe:Drosophila_2:1629406_at:705:89; Interrogation_Position=818; Antisense; AGTATGGAAAGTACAGCCGCCGCGC
>probe:Drosophila_2:1629406_at:480:523; Interrogation_Position=850; Antisense; GGGCTCGTGAAGATCTGGCGCAAAA
>probe:Drosophila_2:1629406_at:233:183; Interrogation_Position=871; Antisense; AAAAGCCTCCACATCTATGATCCAC
>probe:Drosophila_2:1629406_at:507:225; Interrogation_Position=919; Antisense; AAGGACAGTAATTCCGACTCGGATT
>probe:Drosophila_2:1629406_at:224:405; Interrogation_Position=934; Antisense; GACTCGGATTCTGACTAGGATCGAA
>probe:Drosophila_2:1629406_at:278:451; Interrogation_Position=952; Antisense; GATCGAATCTTGTTACCGGGCCGGG
>probe:Drosophila_2:1629406_at:554:519; Interrogation_Position=969; Antisense; GGGCCGGGCTATGTTTTTCAAATAT

Paste this into a BLAST search page for me
AAACACGCATCTTCGAGTCACAAGGTCGGCCAACGGAGATGCAGCTGCGCGGCAACAATCCCCATTCGAGGAACTCGCCATCCTAAGTCGCAGGCAGAAGGGAAAGAATACTGCCGCCTACGAGCAAGGACGAGCGGACTCGCGATCATCCGCGCACCCCGAACAAGTATGGAAAAGTATGGAAAGTACAGCCGCCGCGCGGGCTCGTGAAGATCTGGCGCAAAAAAAAGCCTCCACATCTATGATCCACAAGGACAGTAATTCCGACTCGGATTGACTCGGATTCTGACTAGGATCGAAGATCGAATCTTGTTACCGGGCCGGGGGGCCGGGCTATGTTTTTCAAATAT

Full Affymetrix probeset data:

Annotations for 1629406_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime