FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629407_at:

>probe:Drosophila_2:1629407_at:720:547; Interrogation_Position=149; Antisense; GGATGGCTCCACTTAAGCAGTATGG
>probe:Drosophila_2:1629407_at:377:91; Interrogation_Position=167; Antisense; AGTATGGGTATACGCCGCAGCATCT
>probe:Drosophila_2:1629407_at:207:511; Interrogation_Position=212; Antisense; GTGAATTCACCACCTTCGAACTGGG
>probe:Drosophila_2:1629407_at:2:189; Interrogation_Position=244; Antisense; AACTACCAGATTCTCAATCCCGAAG
>probe:Drosophila_2:1629407_at:295:51; Interrogation_Position=313; Antisense; ATGCTGAGGCGACTTACCAGTGGTC
>probe:Drosophila_2:1629407_at:682:181; Interrogation_Position=37; Antisense; AAAATGGTCGGCTGCCCGGAGACAC
>probe:Drosophila_2:1629407_at:455:355; Interrogation_Position=377; Antisense; GCACGGAAACGGTTCGCGAGACTTC
>probe:Drosophila_2:1629407_at:53:425; Interrogation_Position=394; Antisense; GAGACTTCCGATCCGGGTCAATCTA
>probe:Drosophila_2:1629407_at:168:657; Interrogation_Position=488; Antisense; TAAGGAAGCGCAGCTCCATCGAAAA
>probe:Drosophila_2:1629407_at:640:547; Interrogation_Position=552; Antisense; GGATGATCAAAGTTTCTTCCCTGAT
>probe:Drosophila_2:1629407_at:358:603; Interrogation_Position=573; Antisense; TGATATTCAGGTTTACCCCGGCTTA
>probe:Drosophila_2:1629407_at:55:571; Interrogation_Position=592; Antisense; GGCTTACCCTTCCAAAGTCGTGTAG
>probe:Drosophila_2:1629407_at:115:397; Interrogation_Position=62; Antisense; GACAACTACTGGTCACATTGCTATT
>probe:Drosophila_2:1629407_at:282:151; Interrogation_Position=76; Antisense; ACATTGCTATTGACCCTTGGCTTCT

Paste this into a BLAST search page for me
GGATGGCTCCACTTAAGCAGTATGGAGTATGGGTATACGCCGCAGCATCTGTGAATTCACCACCTTCGAACTGGGAACTACCAGATTCTCAATCCCGAAGATGCTGAGGCGACTTACCAGTGGTCAAAATGGTCGGCTGCCCGGAGACACGCACGGAAACGGTTCGCGAGACTTCGAGACTTCCGATCCGGGTCAATCTATAAGGAAGCGCAGCTCCATCGAAAAGGATGATCAAAGTTTCTTCCCTGATTGATATTCAGGTTTACCCCGGCTTAGGCTTACCCTTCCAAAGTCGTGTAGGACAACTACTGGTCACATTGCTATTACATTGCTATTGACCCTTGGCTTCT

Full Affymetrix probeset data:

Annotations for 1629407_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720