Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629410_at:

>probe:Drosophila_2:1629410_at:292:287; Interrogation_Position=1732; Antisense; CTGGTGATCAACTGCCGCGAGAAGC
>probe:Drosophila_2:1629410_at:1:421; Interrogation_Position=1768; Antisense; GAGCAGATAGGAGAGCAGCCGCCAC
>probe:Drosophila_2:1629410_at:521:349; Interrogation_Position=1794; Antisense; GCAGGATAGCAACCACACCAAGAAT
>probe:Drosophila_2:1629410_at:665:97; Interrogation_Position=1834; Antisense; AGATCCACTGATCCCTGGAAGCAGG
>probe:Drosophila_2:1629410_at:468:563; Interrogation_Position=1850; Antisense; GGAAGCAGGTCCTCCAAGATCGCGA
>probe:Drosophila_2:1629410_at:99:523; Interrogation_Position=1883; Antisense; GGGCCAACTGCAATCGCAGCTGTTT
>probe:Drosophila_2:1629410_at:412:479; Interrogation_Position=1904; Antisense; GTTTCTACAACAATTCGCAGAGCTC
>probe:Drosophila_2:1629410_at:430:583; Interrogation_Position=1955; Antisense; TGGCTAGCAAGTTGAGCTCGCAGCT
>probe:Drosophila_2:1629410_at:592:597; Interrogation_Position=1995; Antisense; TGTCGAATTCCATCGCAGTGTAATA
>probe:Drosophila_2:1629410_at:192:23; Interrogation_Position=2024; Antisense; ATATCAACGACATTGTAGGCCACAA
>probe:Drosophila_2:1629410_at:169:245; Interrogation_Position=2057; Antisense; AATTATTGCAACATCCTGCGATTCT
>probe:Drosophila_2:1629410_at:463:623; Interrogation_Position=2073; Antisense; TGCGATTCTTATCTCTACTGCCAAT
>probe:Drosophila_2:1629410_at:360:489; Interrogation_Position=2136; Antisense; GTACTACTTCTTTTATGGGATCTCA
>probe:Drosophila_2:1629410_at:685:89; Interrogation_Position=2164; Antisense; AGTAACATTATATCGCCACAAGGTG

Paste this into a BLAST search page for me
CTGGTGATCAACTGCCGCGAGAAGCGAGCAGATAGGAGAGCAGCCGCCACGCAGGATAGCAACCACACCAAGAATAGATCCACTGATCCCTGGAAGCAGGGGAAGCAGGTCCTCCAAGATCGCGAGGGCCAACTGCAATCGCAGCTGTTTGTTTCTACAACAATTCGCAGAGCTCTGGCTAGCAAGTTGAGCTCGCAGCTTGTCGAATTCCATCGCAGTGTAATAATATCAACGACATTGTAGGCCACAAAATTATTGCAACATCCTGCGATTCTTGCGATTCTTATCTCTACTGCCAATGTACTACTTCTTTTATGGGATCTCAAGTAACATTATATCGCCACAAGGTG

Full Affymetrix probeset data:

Annotations for 1629410_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime