FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629411_at:

>probe:Drosophila_2:1629411_at:66:83; Interrogation_Position=1006; Antisense; AGGGACTCCATCATTTACCGCATGA
>probe:Drosophila_2:1629411_at:593:411; Interrogation_Position=1029; Antisense; GACCTCTACCCGCATCAAGAAGGAC
>probe:Drosophila_2:1629411_at:639:325; Interrogation_Position=1101; Antisense; GCGAGAGGAGCTTGCGTTACGCTTT
>probe:Drosophila_2:1629411_at:578:623; Interrogation_Position=1113; Antisense; TGCGTTACGCTTTGTTATTTCGTCC
>probe:Drosophila_2:1629411_at:582:189; Interrogation_Position=1160; Antisense; AACTTCTACTTCAATCCAACAGCGG
>probe:Drosophila_2:1629411_at:546:263; Interrogation_Position=1213; Antisense; CAGCTGTCGCAGTAGTTGGTTTTAT
>probe:Drosophila_2:1629411_at:281:697; Interrogation_Position=1271; Antisense; TTTCAATGCAGTTGCGGGCGTCGCA
>probe:Drosophila_2:1629411_at:351:683; Interrogation_Position=1365; Antisense; TATGCACAACATACTCGCCAAGTCA
>probe:Drosophila_2:1629411_at:125:299; Interrogation_Position=1380; Antisense; CGCCAAGTCAGTCAGTTCTTCAAAC
>probe:Drosophila_2:1629411_at:270:667; Interrogation_Position=895; Antisense; TACTACGGCAGCGACTACCCGGTGA
>probe:Drosophila_2:1629411_at:76:143; Interrogation_Position=908; Antisense; ACTACCCGGTGATCTTCAACATCAT
>probe:Drosophila_2:1629411_at:565:189; Interrogation_Position=925; Antisense; AACATCATCCTGTGGTTCATGGTCG
>probe:Drosophila_2:1629411_at:576:711; Interrogation_Position=940; Antisense; TTCATGGTCGTCTTCGGACTGTCTC
>probe:Drosophila_2:1629411_at:252:407; Interrogation_Position=956; Antisense; GACTGTCTCTGCTGGCTATCTGCTA

Paste this into a BLAST search page for me
AGGGACTCCATCATTTACCGCATGAGACCTCTACCCGCATCAAGAAGGACGCGAGAGGAGCTTGCGTTACGCTTTTGCGTTACGCTTTGTTATTTCGTCCAACTTCTACTTCAATCCAACAGCGGCAGCTGTCGCAGTAGTTGGTTTTATTTTCAATGCAGTTGCGGGCGTCGCATATGCACAACATACTCGCCAAGTCACGCCAAGTCAGTCAGTTCTTCAAACTACTACGGCAGCGACTACCCGGTGAACTACCCGGTGATCTTCAACATCATAACATCATCCTGTGGTTCATGGTCGTTCATGGTCGTCTTCGGACTGTCTCGACTGTCTCTGCTGGCTATCTGCTA

Full Affymetrix probeset data:

Annotations for 1629411_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720