Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629413_at:

>probe:Drosophila_2:1629413_at:22:353; Interrogation_Position=2382; Antisense; GCAGCTACGAGTTTGCGACCATCGA
>probe:Drosophila_2:1629413_at:494:453; Interrogation_Position=2405; Antisense; GATCAGGATAAGGACCACTTCGGTT
>probe:Drosophila_2:1629413_at:358:143; Interrogation_Position=2436; Antisense; ACTAGCAATTTCCATTCTTCAAGCC
>probe:Drosophila_2:1629413_at:499:205; Interrogation_Position=2456; Antisense; AAGCCCAAGCCCGATGATGATCATA
>probe:Drosophila_2:1629413_at:134:445; Interrogation_Position=2468; Antisense; GATGATGATCATACCGCTCTGGCTT
>probe:Drosophila_2:1629413_at:419:629; Interrogation_Position=2512; Antisense; TCCTCCATGCGGTGCACTGTATATA
>probe:Drosophila_2:1629413_at:270:167; Interrogation_Position=2563; Antisense; AAATGCTTCCTTGTTTCGATTGTGA
>probe:Drosophila_2:1629413_at:389:725; Interrogation_Position=2588; Antisense; TTGTTTCTTTTGTACGCTATTCCAC
>probe:Drosophila_2:1629413_at:195:341; Interrogation_Position=2603; Antisense; GCTATTCCACACTATATTCCGTTTT
>probe:Drosophila_2:1629413_at:198:303; Interrogation_Position=2621; Antisense; CCGTTTTATATAATTCCCTCGCTGG
>probe:Drosophila_2:1629413_at:312:241; Interrogation_Position=2755; Antisense; AATAACACACCCATACCTGTAGTAG
>probe:Drosophila_2:1629413_at:580:485; Interrogation_Position=2773; Antisense; GTAGTAGACCTGCATACCGCACAAG
>probe:Drosophila_2:1629413_at:206:161; Interrogation_Position=2793; Antisense; ACAAGTCCCAAATCGCGCATAGAGA
>probe:Drosophila_2:1629413_at:302:585; Interrogation_Position=2885; Antisense; TGGAATGGAACCTTGCACGGCAATA

Paste this into a BLAST search page for me
GCAGCTACGAGTTTGCGACCATCGAGATCAGGATAAGGACCACTTCGGTTACTAGCAATTTCCATTCTTCAAGCCAAGCCCAAGCCCGATGATGATCATAGATGATGATCATACCGCTCTGGCTTTCCTCCATGCGGTGCACTGTATATAAAATGCTTCCTTGTTTCGATTGTGATTGTTTCTTTTGTACGCTATTCCACGCTATTCCACACTATATTCCGTTTTCCGTTTTATATAATTCCCTCGCTGGAATAACACACCCATACCTGTAGTAGGTAGTAGACCTGCATACCGCACAAGACAAGTCCCAAATCGCGCATAGAGATGGAATGGAACCTTGCACGGCAATA

Full Affymetrix probeset data:

Annotations for 1629413_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime