Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629416_s_at:

>probe:Drosophila_2:1629416_s_at:314:121; Interrogation_Position=103; Antisense; AGCGGAGTTTCTGTTCTGGCTGAAC
>probe:Drosophila_2:1629416_s_at:497:387; Interrogation_Position=16; Antisense; GAAAAAGTCTACTTTCACGGCCCAT
>probe:Drosophila_2:1629416_s_at:559:443; Interrogation_Position=166; Antisense; GATGATGATGTGATTCCACCGGCTT
>probe:Drosophila_2:1629416_s_at:173:629; Interrogation_Position=180; Antisense; TCCACCGGCTTGCTTCAATTATAGG
>probe:Drosophila_2:1629416_s_at:86:721; Interrogation_Position=208; Antisense; TTGCGCAAATCCTTCAAACTTTCGC
>probe:Drosophila_2:1629416_s_at:65:1; Interrogation_Position=228; Antisense; TTCGCCCCTAGGCAAAAGTTCGGCA
>probe:Drosophila_2:1629416_s_at:120:171; Interrogation_Position=242; Antisense; AAAGTTCGGCACCAAATCTGCCCAA
>probe:Drosophila_2:1629416_s_at:415:165; Interrogation_Position=255; Antisense; AAATCTGCCCAAGTCGCTGGGTAGC
>probe:Drosophila_2:1629416_s_at:175:539; Interrogation_Position=274; Antisense; GGTAGCGGAACTGCCATCTTATTAG
>probe:Drosophila_2:1629416_s_at:531:31; Interrogation_Position=289; Antisense; ATCTTATTAGCGCTCTTCTCGACTT
>probe:Drosophila_2:1629416_s_at:383:577; Interrogation_Position=34; Antisense; GGCCCATTCACGTGGATCCAATTAA
>probe:Drosophila_2:1629416_s_at:485:545; Interrogation_Position=47; Antisense; GGATCCAATTAAAGTTGCCACTCTG
>probe:Drosophila_2:1629416_s_at:414:701; Interrogation_Position=76; Antisense; TTTTCCCAACAGCAAAGCCATCGAT
>probe:Drosophila_2:1629416_s_at:717:313; Interrogation_Position=92; Antisense; GCCATCGATGGAGCGGAGTTTCTGT

Paste this into a BLAST search page for me
AGCGGAGTTTCTGTTCTGGCTGAACGAAAAAGTCTACTTTCACGGCCCATGATGATGATGTGATTCCACCGGCTTTCCACCGGCTTGCTTCAATTATAGGTTGCGCAAATCCTTCAAACTTTCGCTTCGCCCCTAGGCAAAAGTTCGGCAAAAGTTCGGCACCAAATCTGCCCAAAAATCTGCCCAAGTCGCTGGGTAGCGGTAGCGGAACTGCCATCTTATTAGATCTTATTAGCGCTCTTCTCGACTTGGCCCATTCACGTGGATCCAATTAAGGATCCAATTAAAGTTGCCACTCTGTTTTCCCAACAGCAAAGCCATCGATGCCATCGATGGAGCGGAGTTTCTGT

Full Affymetrix probeset data:

Annotations for 1629416_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime