Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629421_at:

>probe:Drosophila_2:1629421_at:399:577; Interrogation_Position=2120; Antisense; GGCGCCATGTCACATGCCTGGAAAA
>probe:Drosophila_2:1629421_at:581:473; Interrogation_Position=2149; Antisense; GTTACACGATTACTCTGGTGGCATT
>probe:Drosophila_2:1629421_at:307:521; Interrogation_Position=2166; Antisense; GTGGCATTTCCAATCTGGACACCAG
>probe:Drosophila_2:1629421_at:102:583; Interrogation_Position=2212; Antisense; TGGCTATACCATTGGGTCCATCGAT
>probe:Drosophila_2:1629421_at:430:505; Interrogation_Position=2227; Antisense; GTCCATCGATGCGTGCCTCAAGGAG
>probe:Drosophila_2:1629421_at:322:445; Interrogation_Position=2254; Antisense; GATGACCTGCAAGCGGAAACTCCAG
>probe:Drosophila_2:1629421_at:222:415; Interrogation_Position=2296; Antisense; GACCAATGCCGAACTGATCAATGTT
>probe:Drosophila_2:1629421_at:716:229; Interrogation_Position=2315; Antisense; AATGTTCTGTGCTCACGAGATCCCG
>probe:Drosophila_2:1629421_at:184:97; Interrogation_Position=2332; Antisense; AGATCCCGTCTACCGCGAAGAGGAG
>probe:Drosophila_2:1629421_at:720:377; Interrogation_Position=2357; Antisense; GAAGCTTTCGAGTCCTGGTGGTCGA
>probe:Drosophila_2:1629421_at:372:79; Interrogation_Position=2502; Antisense; AGGTAATCACTGGACTTCTTATATT
>probe:Drosophila_2:1629421_at:167:591; Interrogation_Position=2565; Antisense; TGGTAACCATTCATTCAACGCTATG
>probe:Drosophila_2:1629421_at:563:273; Interrogation_Position=2576; Antisense; CATTCAACGCTATGGCTTGCTTTAC
>probe:Drosophila_2:1629421_at:310:571; Interrogation_Position=2589; Antisense; GGCTTGCTTTACAATCTTGCTTTTA

Paste this into a BLAST search page for me
GGCGCCATGTCACATGCCTGGAAAAGTTACACGATTACTCTGGTGGCATTGTGGCATTTCCAATCTGGACACCAGTGGCTATACCATTGGGTCCATCGATGTCCATCGATGCGTGCCTCAAGGAGGATGACCTGCAAGCGGAAACTCCAGGACCAATGCCGAACTGATCAATGTTAATGTTCTGTGCTCACGAGATCCCGAGATCCCGTCTACCGCGAAGAGGAGGAAGCTTTCGAGTCCTGGTGGTCGAAGGTAATCACTGGACTTCTTATATTTGGTAACCATTCATTCAACGCTATGCATTCAACGCTATGGCTTGCTTTACGGCTTGCTTTACAATCTTGCTTTTA

Full Affymetrix probeset data:

Annotations for 1629421_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime