FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629423_at:

>probe:Drosophila_2:1629423_at:106:329; Interrogation_Position=1001; Antisense; GCGTATTTCTGCAATGTGCCTTGAC
>probe:Drosophila_2:1629423_at:614:503; Interrogation_Position=1016; Antisense; GTGCCTTGACCCTTAGTTTCACTAA
>probe:Drosophila_2:1629423_at:594:329; Interrogation_Position=473; Antisense; GCGTGCTCTGTATCTGGGCGACAAT
>probe:Drosophila_2:1629423_at:485:367; Interrogation_Position=536; Antisense; GAATCTGCAGATACTCGGATTGCGT
>probe:Drosophila_2:1629423_at:310:397; Interrogation_Position=561; Antisense; GACAACGATCTTCTGGAATTGCCCC
>probe:Drosophila_2:1629423_at:162:297; Interrogation_Position=606; Antisense; CGACTGCGGGAGCTACATATTCAAA
>probe:Drosophila_2:1629423_at:459:25; Interrogation_Position=634; Antisense; ATAGGCTGCAGGTGCTGCCACCAGA
>probe:Drosophila_2:1629423_at:309:427; Interrogation_Position=657; Antisense; GAGATCGCCCAGTTGGACCTACTGA
>probe:Drosophila_2:1629423_at:288:435; Interrogation_Position=705; Antisense; GAGGAGAATCCCTGGGTCAATCCCA
>probe:Drosophila_2:1629423_at:710:39; Interrogation_Position=742; Antisense; ATCTGCTGGGCATTAGTCACGTCAT
>probe:Drosophila_2:1629423_at:41:687; Interrogation_Position=789; Antisense; TATAAGATCATCTACAACCGCCACT
>probe:Drosophila_2:1629423_at:337:209; Interrogation_Position=861; Antisense; AAGAAGGCCTCTCGAATTCGCGCAT
>probe:Drosophila_2:1629423_at:430:323; Interrogation_Position=880; Antisense; GCGCATAGTGATTCTCCACCAGAAG
>probe:Drosophila_2:1629423_at:274:159; Interrogation_Position=926; Antisense; ACAAATGTGTTCGTCTCGTTCGTTG

Paste this into a BLAST search page for me
GCGTATTTCTGCAATGTGCCTTGACGTGCCTTGACCCTTAGTTTCACTAAGCGTGCTCTGTATCTGGGCGACAATGAATCTGCAGATACTCGGATTGCGTGACAACGATCTTCTGGAATTGCCCCCGACTGCGGGAGCTACATATTCAAAATAGGCTGCAGGTGCTGCCACCAGAGAGATCGCCCAGTTGGACCTACTGAGAGGAGAATCCCTGGGTCAATCCCAATCTGCTGGGCATTAGTCACGTCATTATAAGATCATCTACAACCGCCACTAAGAAGGCCTCTCGAATTCGCGCATGCGCATAGTGATTCTCCACCAGAAGACAAATGTGTTCGTCTCGTTCGTTG

Full Affymetrix probeset data:

Annotations for 1629423_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720