FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629425_at:

>probe:Drosophila_2:1629425_at:540:195; Interrogation_Position=1025; Antisense; AACTGAGTGTTCCAGAGACCGTGCC
>probe:Drosophila_2:1629425_at:697:103; Interrogation_Position=1040; Antisense; AGACCGTGCCGCTGAATATAACCCG
>probe:Drosophila_2:1629425_at:53:303; Interrogation_Position=1062; Antisense; CCGGGTGGGCATTCCTTACGAGGAT
>probe:Drosophila_2:1629425_at:632:75; Interrogation_Position=1100; Antisense; AGGAGCCAACCATATGTGTGCCTCT
>probe:Drosophila_2:1629425_at:401:435; Interrogation_Position=1177; Antisense; GAGGTCGAAAGGGTCTACTGCTTCC
>probe:Drosophila_2:1629425_at:441:519; Interrogation_Position=1213; Antisense; GTGGAGATACGTCCTGGTCATGCTC
>probe:Drosophila_2:1629425_at:485:591; Interrogation_Position=1227; Antisense; TGGTCATGCTCGTCCGCAGGTAGAA
>probe:Drosophila_2:1629425_at:720:199; Interrogation_Position=1302; Antisense; AACCCAAGTGGCTATACCGAGTGAT
>probe:Drosophila_2:1629425_at:466:215; Interrogation_Position=1347; Antisense; AAGATCACTTGGCACGCTCGCGGTG
>probe:Drosophila_2:1629425_at:114:691; Interrogation_Position=1380; Antisense; TATTGCTTGGAGCTTCCGGCGAGAA
>probe:Drosophila_2:1629425_at:135:449; Interrogation_Position=839; Antisense; GATCCACTGCGGGTCTATTGAATTG
>probe:Drosophila_2:1629425_at:438:613; Interrogation_Position=857; Antisense; TGAATTGGCCCACTGATTTCATCGA
>probe:Drosophila_2:1629425_at:307:457; Interrogation_Position=880; Antisense; GATAGCACATCCCTTACGGTGAGCA
>probe:Drosophila_2:1629425_at:365:417; Interrogation_Position=954; Antisense; GAGCGTCTCTGATCCTGTGGACGAA

Paste this into a BLAST search page for me
AACTGAGTGTTCCAGAGACCGTGCCAGACCGTGCCGCTGAATATAACCCGCCGGGTGGGCATTCCTTACGAGGATAGGAGCCAACCATATGTGTGCCTCTGAGGTCGAAAGGGTCTACTGCTTCCGTGGAGATACGTCCTGGTCATGCTCTGGTCATGCTCGTCCGCAGGTAGAAAACCCAAGTGGCTATACCGAGTGATAAGATCACTTGGCACGCTCGCGGTGTATTGCTTGGAGCTTCCGGCGAGAAGATCCACTGCGGGTCTATTGAATTGTGAATTGGCCCACTGATTTCATCGAGATAGCACATCCCTTACGGTGAGCAGAGCGTCTCTGATCCTGTGGACGAA

Full Affymetrix probeset data:

Annotations for 1629425_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720