Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629426_s_at:

>probe:Drosophila_2:1629426_s_at:709:727; Interrogation_Position=380; Antisense; TTGGTGCGGACCCTGCAAGATGATC
>probe:Drosophila_2:1629426_s_at:599:443; Interrogation_Position=398; Antisense; GATGATCTCGCCCAAACTGGTTGAG
>probe:Drosophila_2:1629426_s_at:689:175; Interrogation_Position=411; Antisense; AAACTGGTTGAGCTTTCCACGCAGT
>probe:Drosophila_2:1629426_s_at:546:195; Interrogation_Position=444; Antisense; AACGTCGTCGTCCTGAAGGTCGATG
>probe:Drosophila_2:1629426_s_at:470:469; Interrogation_Position=527; Antisense; GTTCCTCAAGAACGGCGTCAAGGTC
>probe:Drosophila_2:1629426_s_at:529:79; Interrogation_Position=547; Antisense; AGGTCGAAGAGTTCGCCGGAGCCAA
>probe:Drosophila_2:1629426_s_at:297:415; Interrogation_Position=565; Antisense; GAGCCAACGCCAAGCGTCTGGAGGA
>probe:Drosophila_2:1629426_s_at:124:311; Interrogation_Position=601; Antisense; CCAATATCTAAGTGGGCAGCGCATA
>probe:Drosophila_2:1629426_s_at:224:305; Interrogation_Position=642; Antisense; CCTGATCCACCTATGAGTTTTCTTC
>probe:Drosophila_2:1629426_s_at:721:657; Interrogation_Position=695; Antisense; TAAGTGCAGGGTTTTGCTCCATTCC
>probe:Drosophila_2:1629426_s_at:712:273; Interrogation_Position=737; Antisense; CTTGAATCCCTTAGAGCTGCAGTGC
>probe:Drosophila_2:1629426_s_at:377:335; Interrogation_Position=752; Antisense; GCTGCAGTGCAGTTCGCAAGGTGAA
>probe:Drosophila_2:1629426_s_at:435:199; Interrogation_Position=910; Antisense; AACGCAGTTGTAGCCAGTTGTCCAA
>probe:Drosophila_2:1629426_s_at:570:229; Interrogation_Position=954; Antisense; AATGTATTACACACTCGCCGTTTGT

Paste this into a BLAST search page for me
TTGGTGCGGACCCTGCAAGATGATCGATGATCTCGCCCAAACTGGTTGAGAAACTGGTTGAGCTTTCCACGCAGTAACGTCGTCGTCCTGAAGGTCGATGGTTCCTCAAGAACGGCGTCAAGGTCAGGTCGAAGAGTTCGCCGGAGCCAAGAGCCAACGCCAAGCGTCTGGAGGACCAATATCTAAGTGGGCAGCGCATACCTGATCCACCTATGAGTTTTCTTCTAAGTGCAGGGTTTTGCTCCATTCCCTTGAATCCCTTAGAGCTGCAGTGCGCTGCAGTGCAGTTCGCAAGGTGAAAACGCAGTTGTAGCCAGTTGTCCAAAATGTATTACACACTCGCCGTTTGT

Full Affymetrix probeset data:

Annotations for 1629426_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime