FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629427_at:

>probe:Drosophila_2:1629427_at:58:609; Interrogation_Position=2599; Antisense; TGAGATTAGCAAGCGCCATCATCCG
>probe:Drosophila_2:1629427_at:464:45; Interrogation_Position=2619; Antisense; ATCCGCAACTCAGTTTGTTTGCCCA
>probe:Drosophila_2:1629427_at:508:601; Interrogation_Position=2634; Antisense; TGTTTGCCCAGAATACGGACTCGGA
>probe:Drosophila_2:1629427_at:234:371; Interrogation_Position=2657; Antisense; GAAGGAGTGCTTCGTCGTCATTTGC
>probe:Drosophila_2:1629427_at:484:33; Interrogation_Position=2687; Antisense; ATCAAGGTGTTATCTCGCTGCGAAG
>probe:Drosophila_2:1629427_at:590:193; Interrogation_Position=2757; Antisense; AACTCAGCTACTTCTCAACGGCAGG
>probe:Drosophila_2:1629427_at:485:281; Interrogation_Position=2786; Antisense; CTCTGCTCCTTTGGCTTGAAATTGA
>probe:Drosophila_2:1629427_at:258:293; Interrogation_Position=2812; Antisense; CGATGGATTGGATCTGACGCCGGAA
>probe:Drosophila_2:1629427_at:171:121; Interrogation_Position=2898; Antisense; AGCGGTATCGCATGCGCCTGGATAA
>probe:Drosophila_2:1629427_at:404:203; Interrogation_Position=2925; Antisense; AAGCCTTCCAACTGATGGCCGACAA
>probe:Drosophila_2:1629427_at:1:575; Interrogation_Position=2992; Antisense; GGCGGAAATCAACAGTCTCACTCGG
>probe:Drosophila_2:1629427_at:380:145; Interrogation_Position=3011; Antisense; ACTCGGCTGGCAGTATTGTCCTAAT
>probe:Drosophila_2:1629427_at:290:725; Interrogation_Position=3068; Antisense; TTGTTATTGACTTACATCCGCCTAA
>probe:Drosophila_2:1629427_at:78:45; Interrogation_Position=3083; Antisense; ATCCGCCTAAGTCATCTGTTTGTTT

Paste this into a BLAST search page for me
TGAGATTAGCAAGCGCCATCATCCGATCCGCAACTCAGTTTGTTTGCCCATGTTTGCCCAGAATACGGACTCGGAGAAGGAGTGCTTCGTCGTCATTTGCATCAAGGTGTTATCTCGCTGCGAAGAACTCAGCTACTTCTCAACGGCAGGCTCTGCTCCTTTGGCTTGAAATTGACGATGGATTGGATCTGACGCCGGAAAGCGGTATCGCATGCGCCTGGATAAAAGCCTTCCAACTGATGGCCGACAAGGCGGAAATCAACAGTCTCACTCGGACTCGGCTGGCAGTATTGTCCTAATTTGTTATTGACTTACATCCGCCTAAATCCGCCTAAGTCATCTGTTTGTTT

Full Affymetrix probeset data:

Annotations for 1629427_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720