Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629428_at:

>probe:Drosophila_2:1629428_at:80:297; Interrogation_Position=1237; Antisense; CGCTTTGGAGTGACAGTGGCCTACA
>probe:Drosophila_2:1629428_at:124:577; Interrogation_Position=1269; Antisense; GGCGCAATATGCCACCGAGCTGATC
>probe:Drosophila_2:1629428_at:616:49; Interrogation_Position=1343; Antisense; ATGCCTTCACCTTCTTCAGTGCGTA
>probe:Drosophila_2:1629428_at:316:649; Interrogation_Position=1358; Antisense; TCAGTGCGTACATCCTGTTCACGAG
>probe:Drosophila_2:1629428_at:304:601; Interrogation_Position=1373; Antisense; TGTTCACGAGGAGCGTATTCTCGCC
>probe:Drosophila_2:1629428_at:380:689; Interrogation_Position=1388; Antisense; TATTCTCGCCGCTACCGGAGATTAT
>probe:Drosophila_2:1629428_at:405:289; Interrogation_Position=1403; Antisense; CGGAGATTATCTTGGGCGTGCTTTC
>probe:Drosophila_2:1629428_at:43:559; Interrogation_Position=1475; Antisense; GGACATTGCCCACTTCTTTGGAAGA
>probe:Drosophila_2:1629428_at:331:517; Interrogation_Position=1527; Antisense; GTGGTACACCTTTAGTTTTCTGGAG
>probe:Drosophila_2:1629428_at:442:421; Interrogation_Position=1549; Antisense; GAGGGACGAACTCAATCAGCCGCCA
>probe:Drosophila_2:1629428_at:615:141; Interrogation_Position=1575; Antisense; ACTGGACACCCAAAACGCGAAAATG
>probe:Drosophila_2:1629428_at:438:489; Interrogation_Position=1599; Antisense; GTACTCGCAGTCAACGGAATCGGCC
>probe:Drosophila_2:1629428_at:317:363; Interrogation_Position=1615; Antisense; GAATCGGCCGTCTACTTTTGAGTAA
>probe:Drosophila_2:1629428_at:647:583; Interrogation_Position=1654; Antisense; TGGAACTCGGTTATACTGGACTTGT

Paste this into a BLAST search page for me
CGCTTTGGAGTGACAGTGGCCTACAGGCGCAATATGCCACCGAGCTGATCATGCCTTCACCTTCTTCAGTGCGTATCAGTGCGTACATCCTGTTCACGAGTGTTCACGAGGAGCGTATTCTCGCCTATTCTCGCCGCTACCGGAGATTATCGGAGATTATCTTGGGCGTGCTTTCGGACATTGCCCACTTCTTTGGAAGAGTGGTACACCTTTAGTTTTCTGGAGGAGGGACGAACTCAATCAGCCGCCAACTGGACACCCAAAACGCGAAAATGGTACTCGCAGTCAACGGAATCGGCCGAATCGGCCGTCTACTTTTGAGTAATGGAACTCGGTTATACTGGACTTGT

Full Affymetrix probeset data:

Annotations for 1629428_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime