FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629429_at:

>probe:Drosophila_2:1629429_at:10:87; Interrogation_Position=1013; Antisense; AGTGCAGCGCATCCTTTTATACAGC
>probe:Drosophila_2:1629429_at:378:319; Interrogation_Position=1039; Antisense; GCCGAACTCTGTTCCCATCAGAAAA
>probe:Drosophila_2:1629429_at:493:151; Interrogation_Position=1085; Antisense; ACATCTGTCGCTACAACTGTGGCAA
>probe:Drosophila_2:1629429_at:517:393; Interrogation_Position=1144; Antisense; GAAAGGGTTCACATGGACGCCAGCA
>probe:Drosophila_2:1629429_at:583:263; Interrogation_Position=1164; Antisense; CAGCAAGCGTATCTACCAGTGCGAG
>probe:Drosophila_2:1629429_at:212:623; Interrogation_Position=1192; Antisense; TGCCCCAAGTCGTATGTAACACCCA
>probe:Drosophila_2:1629429_at:190:491; Interrogation_Position=1207; Antisense; GTAACACCCAGCGAGTGCAGGACAC
>probe:Drosophila_2:1629429_at:412:483; Interrogation_Position=1239; Antisense; GTATCACAACTTGACTCGCGATCAC
>probe:Drosophila_2:1629429_at:472:165; Interrogation_Position=1271; Antisense; AAATCTGCCGCATAAGCTTCAAGAC
>probe:Drosophila_2:1629429_at:445:623; Interrogation_Position=1329; Antisense; TGCCCACAAAACTCTGGAGGCGCGT
>probe:Drosophila_2:1629429_at:391:439; Interrogation_Position=1345; Antisense; GAGGCGCGTGCTAAAGCTGCTGCAT
>probe:Drosophila_2:1629429_at:295:687; Interrogation_Position=1452; Antisense; TATTAATAAAGCTTCCGTTCCGCGT
>probe:Drosophila_2:1629429_at:238:641; Interrogation_Position=942; Antisense; TCTGACCACGGCCTTTAATCTGAAG
>probe:Drosophila_2:1629429_at:710:235; Interrogation_Position=958; Antisense; AATCTGAAGAATCACCTGGTTCGCC

Paste this into a BLAST search page for me
AGTGCAGCGCATCCTTTTATACAGCGCCGAACTCTGTTCCCATCAGAAAAACATCTGTCGCTACAACTGTGGCAAGAAAGGGTTCACATGGACGCCAGCACAGCAAGCGTATCTACCAGTGCGAGTGCCCCAAGTCGTATGTAACACCCAGTAACACCCAGCGAGTGCAGGACACGTATCACAACTTGACTCGCGATCACAAATCTGCCGCATAAGCTTCAAGACTGCCCACAAAACTCTGGAGGCGCGTGAGGCGCGTGCTAAAGCTGCTGCATTATTAATAAAGCTTCCGTTCCGCGTTCTGACCACGGCCTTTAATCTGAAGAATCTGAAGAATCACCTGGTTCGCC

Full Affymetrix probeset data:

Annotations for 1629429_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720