Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629430_s_at:

>probe:Drosophila_2:1629430_s_at:659:343; Interrogation_Position=195; Antisense; GCATTCAGTTTGAACGCGCTACTCA
>probe:Drosophila_2:1629430_s_at:109:91; Interrogation_Position=201; Antisense; AGTTTGAACGCGCTACTCAACGGAG
>probe:Drosophila_2:1629430_s_at:33:201; Interrogation_Position=207; Antisense; AACGCGCTACTCAACGGAGCCGTGT
>probe:Drosophila_2:1629430_s_at:9:653; Interrogation_Position=217; Antisense; TCAACGGAGCCGTGTCCAAGGATTC
>probe:Drosophila_2:1629430_s_at:162:197; Interrogation_Position=219; Antisense; AACGGAGCCGTGTCCAAGGATTCTC
>probe:Drosophila_2:1629430_s_at:51:417; Interrogation_Position=223; Antisense; GAGCCGTGTCCAAGGATTCTCGATT
>probe:Drosophila_2:1629430_s_at:258:515; Interrogation_Position=228; Antisense; GTGTCCAAGGATTCTCGATTCTCTA
>probe:Drosophila_2:1629430_s_at:404:505; Interrogation_Position=230; Antisense; GTCCAAGGATTCTCGATTCTCTATT
>probe:Drosophila_2:1629430_s_at:600:251; Interrogation_Position=233; Antisense; CAAGGATTCTCGATTCTCTATTCTC
>probe:Drosophila_2:1629430_s_at:313:543; Interrogation_Position=236; Antisense; GGATTCTCGATTCTCTATTCTCGAT
>probe:Drosophila_2:1629430_s_at:434:715; Interrogation_Position=239; Antisense; TTCTCGATTCTCTATTCTCGATTCC
>probe:Drosophila_2:1629430_s_at:146:13; Interrogation_Position=245; Antisense; ATTCTCTATTCTCGATTCCCCATCT
>probe:Drosophila_2:1629430_s_at:667:307; Interrogation_Position=264; Antisense; CCATCTCTCAGCTCAAGCTTAAGCT
>probe:Drosophila_2:1629430_s_at:17:119; Interrogation_Position=273; Antisense; AGCTCAAGCTTAAGCTATCTCCAAG

Paste this into a BLAST search page for me
GCATTCAGTTTGAACGCGCTACTCAAGTTTGAACGCGCTACTCAACGGAGAACGCGCTACTCAACGGAGCCGTGTTCAACGGAGCCGTGTCCAAGGATTCAACGGAGCCGTGTCCAAGGATTCTCGAGCCGTGTCCAAGGATTCTCGATTGTGTCCAAGGATTCTCGATTCTCTAGTCCAAGGATTCTCGATTCTCTATTCAAGGATTCTCGATTCTCTATTCTCGGATTCTCGATTCTCTATTCTCGATTTCTCGATTCTCTATTCTCGATTCCATTCTCTATTCTCGATTCCCCATCTCCATCTCTCAGCTCAAGCTTAAGCTAGCTCAAGCTTAAGCTATCTCCAAG

Full Affymetrix probeset data:

Annotations for 1629430_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime