Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629431_at:

>probe:Drosophila_2:1629431_at:696:213; Interrogation_Position=1010; Antisense; AAGAGTCTACGCGAACAACAGCTGA
>probe:Drosophila_2:1629431_at:710:187; Interrogation_Position=1026; Antisense; AACAGCTGATGGTCATGCCGGTTAC
>probe:Drosophila_2:1629431_at:700:7; Interrogation_Position=1061; Antisense; ATTCCTCTGGCGGTTTCGGGCATTG
>probe:Drosophila_2:1629431_at:243:415; Interrogation_Position=1108; Antisense; GAGCGCCCACTACGAAGGACCGGAT
>probe:Drosophila_2:1629431_at:63:111; Interrogation_Position=1136; Antisense; AGAAGGAATCCTCCCGACGAGCTAC
>probe:Drosophila_2:1629431_at:625:671; Interrogation_Position=1158; Antisense; TACCCATGGTTACCGCACTTGAGAG
>probe:Drosophila_2:1629431_at:689:603; Interrogation_Position=1213; Antisense; TGATTCAGCGCTCCCCAATTATGAG
>probe:Drosophila_2:1629431_at:616:15; Interrogation_Position=1230; Antisense; ATTATGAGGAGTCCCGTCACACTCA
>probe:Drosophila_2:1629431_at:623:561; Interrogation_Position=1276; Antisense; GGAACTACATGCCTTCGGGAGCAAT
>probe:Drosophila_2:1629431_at:514:327; Interrogation_Position=1296; Antisense; GCAATGAGTTTGCTCCACTTTATCC
>probe:Drosophila_2:1629431_at:501:481; Interrogation_Position=1324; Antisense; GTATAGTATACCTAGTCCTACGCCC
>probe:Drosophila_2:1629431_at:535:39; Interrogation_Position=1371; Antisense; ATGCGGGATTCGTCAACCAAAGTTT
>probe:Drosophila_2:1629431_at:136:533; Interrogation_Position=811; Antisense; GGTGAGATACTACAGCGTCAGTCCT
>probe:Drosophila_2:1629431_at:670:495; Interrogation_Position=827; Antisense; GTCAGTCCTGAACACTCTCGAGTGG

Paste this into a BLAST search page for me
AAGAGTCTACGCGAACAACAGCTGAAACAGCTGATGGTCATGCCGGTTACATTCCTCTGGCGGTTTCGGGCATTGGAGCGCCCACTACGAAGGACCGGATAGAAGGAATCCTCCCGACGAGCTACTACCCATGGTTACCGCACTTGAGAGTGATTCAGCGCTCCCCAATTATGAGATTATGAGGAGTCCCGTCACACTCAGGAACTACATGCCTTCGGGAGCAATGCAATGAGTTTGCTCCACTTTATCCGTATAGTATACCTAGTCCTACGCCCATGCGGGATTCGTCAACCAAAGTTTGGTGAGATACTACAGCGTCAGTCCTGTCAGTCCTGAACACTCTCGAGTGG

Full Affymetrix probeset data:

Annotations for 1629431_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime