FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629432_at:

>probe:Drosophila_2:1629432_at:308:35; Interrogation_Position=442; Antisense; ATCAGCACGCTGTGTAACTCTGGCC
>probe:Drosophila_2:1629432_at:471:661; Interrogation_Position=456; Antisense; TAACTCTGGCCTCCTGAAACTGAAA
>probe:Drosophila_2:1629432_at:579:69; Interrogation_Position=494; Antisense; AGTACGGTTTCCAGCTGACGGACGA
>probe:Drosophila_2:1629432_at:544:329; Interrogation_Position=602; Antisense; GCGGTGTAATCCGTACGGCCTATTA
>probe:Drosophila_2:1629432_at:715:649; Interrogation_Position=642; Antisense; TCACATGCTGGCCAATCCGAAGAAG
>probe:Drosophila_2:1629432_at:201:193; Interrogation_Position=676; Antisense; AAGGGAGTACCTATTCCTAGCCGCA
>probe:Drosophila_2:1629432_at:699:445; Interrogation_Position=715; Antisense; GATGCAGTGGACTACTATACGGATC
>probe:Drosophila_2:1629432_at:183:29; Interrogation_Position=731; Antisense; ATACGGATCCCAAGAATCGCGGCTA
>probe:Drosophila_2:1629432_at:483:75; Interrogation_Position=782; Antisense; AGGACCGCCTAGTTCTGGCCCAGAA
>probe:Drosophila_2:1629432_at:551:109; Interrogation_Position=803; Antisense; AGAAGTACGGCTATCAGCTGCCCAA
>probe:Drosophila_2:1629432_at:129:375; Interrogation_Position=835; Antisense; GAAGATTCCGCGTACGAGATGCTCA
>probe:Drosophila_2:1629432_at:155:427; Interrogation_Position=850; Antisense; GAGATGCTCACCACAGCGAAGGATC
>probe:Drosophila_2:1629432_at:427:565; Interrogation_Position=878; Antisense; GGCAAGTATTCTACGGCCTGGAACC
>probe:Drosophila_2:1629432_at:246:201; Interrogation_Position=899; Antisense; AACCCGGCTGGCTGATCAACATAGT

Paste this into a BLAST search page for me
ATCAGCACGCTGTGTAACTCTGGCCTAACTCTGGCCTCCTGAAACTGAAAAGTACGGTTTCCAGCTGACGGACGAGCGGTGTAATCCGTACGGCCTATTATCACATGCTGGCCAATCCGAAGAAGAAGGGAGTACCTATTCCTAGCCGCAGATGCAGTGGACTACTATACGGATCATACGGATCCCAAGAATCGCGGCTAAGGACCGCCTAGTTCTGGCCCAGAAAGAAGTACGGCTATCAGCTGCCCAAGAAGATTCCGCGTACGAGATGCTCAGAGATGCTCACCACAGCGAAGGATCGGCAAGTATTCTACGGCCTGGAACCAACCCGGCTGGCTGATCAACATAGT

Full Affymetrix probeset data:

Annotations for 1629432_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720