Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629433_at:

>probe:Drosophila_2:1629433_at:459:63; Interrogation_Position=1243; Antisense; ATGTGAGAGTGGTGCTCCAGCCCAT
>probe:Drosophila_2:1629433_at:557:307; Interrogation_Position=1264; Antisense; CCATCCTCCCTAGTGATTAACGTTT
>probe:Drosophila_2:1629433_at:236:661; Interrogation_Position=1294; Antisense; TAGTCCGTACGTGTTTAGTTAGCTT
>probe:Drosophila_2:1629433_at:512:415; Interrogation_Position=1322; Antisense; GAGCCAGTTTCGTGGTTCTGTCTAC
>probe:Drosophila_2:1629433_at:38:473; Interrogation_Position=1336; Antisense; GTTCTGTCTACCGTTTAAGCTGCAT
>probe:Drosophila_2:1629433_at:174:607; Interrogation_Position=1401; Antisense; TGACCCTTTGCATTGTTAGTTACAT
>probe:Drosophila_2:1629433_at:708:111; Interrogation_Position=1433; Antisense; AGCAAACTCATTTTCGAACCGACGA
>probe:Drosophila_2:1629433_at:127:233; Interrogation_Position=1457; Antisense; AATCGACTTCGACGCATCCTGGTGA
>probe:Drosophila_2:1629433_at:162:133; Interrogation_Position=1485; Antisense; ACCCGCGCCTCGATTGTATACATAA
>probe:Drosophila_2:1629433_at:83:423; Interrogation_Position=1525; Antisense; GAGAATGCGAATTATCTGCCCGATC
>probe:Drosophila_2:1629433_at:248:37; Interrogation_Position=1555; Antisense; ATCTCTGTCGTCAGTGGCGTTCTAA
>probe:Drosophila_2:1629433_at:440:403; Interrogation_Position=1725; Antisense; GACGGAGGATTACCCATTTACGCGG
>probe:Drosophila_2:1629433_at:240:657; Interrogation_Position=1743; Antisense; TACGCGGGCGAACGAACTGTCTTTA
>probe:Drosophila_2:1629433_at:464:489; Interrogation_Position=1786; Antisense; GTACTCACTGATATTTGCGACCCAA

Paste this into a BLAST search page for me
ATGTGAGAGTGGTGCTCCAGCCCATCCATCCTCCCTAGTGATTAACGTTTTAGTCCGTACGTGTTTAGTTAGCTTGAGCCAGTTTCGTGGTTCTGTCTACGTTCTGTCTACCGTTTAAGCTGCATTGACCCTTTGCATTGTTAGTTACATAGCAAACTCATTTTCGAACCGACGAAATCGACTTCGACGCATCCTGGTGAACCCGCGCCTCGATTGTATACATAAGAGAATGCGAATTATCTGCCCGATCATCTCTGTCGTCAGTGGCGTTCTAAGACGGAGGATTACCCATTTACGCGGTACGCGGGCGAACGAACTGTCTTTAGTACTCACTGATATTTGCGACCCAA

Full Affymetrix probeset data:

Annotations for 1629433_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime