Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629434_at:

>probe:Drosophila_2:1629434_at:469:279; Interrogation_Position=2210; Antisense; CTAACTATTTCTTTGGAGCTGGTGC
>probe:Drosophila_2:1629434_at:423:535; Interrogation_Position=2230; Antisense; GGTGCGAATCGCTATTTGACCATTC
>probe:Drosophila_2:1629434_at:315:489; Interrogation_Position=2285; Antisense; GTACTTCACGCACATATGCATGGCC
>probe:Drosophila_2:1629434_at:176:619; Interrogation_Position=2301; Antisense; TGCATGGCCGCAACAGAACTCAACT
>probe:Drosophila_2:1629434_at:173:193; Interrogation_Position=2322; Antisense; AACTACTCTTTCTACGACAAACTCG
>probe:Drosophila_2:1629434_at:263:337; Interrogation_Position=2387; Antisense; GCTACGATCTTTCAAATGCCTGCGA
>probe:Drosophila_2:1629434_at:126:317; Interrogation_Position=2404; Antisense; GCCTGCGAGGGCTACTATACTATCA
>probe:Drosophila_2:1629434_at:577:685; Interrogation_Position=2424; Antisense; TATCACCCAGTGTCCAGACTTGTAT
>probe:Drosophila_2:1629434_at:209:483; Interrogation_Position=2445; Antisense; GTATTTGTCAGTCCAAGCTACATCA
>probe:Drosophila_2:1629434_at:675:649; Interrogation_Position=2467; Antisense; TCAAACACCACGTCCTGTATACAGG
>probe:Drosophila_2:1629434_at:250:483; Interrogation_Position=2483; Antisense; GTATACAGGATGCTTGCCAGACCCC
>probe:Drosophila_2:1629434_at:432:103; Interrogation_Position=2501; Antisense; AGACCCCTGATCAATGGCGTTATAT
>probe:Drosophila_2:1629434_at:474:153; Interrogation_Position=2540; Antisense; ACATGGGATGCTACAGCGGTGTCTC
>probe:Drosophila_2:1629434_at:540:515; Interrogation_Position=2558; Antisense; GTGTCTCGGGTATAGCAGCCAGTTT

Paste this into a BLAST search page for me
CTAACTATTTCTTTGGAGCTGGTGCGGTGCGAATCGCTATTTGACCATTCGTACTTCACGCACATATGCATGGCCTGCATGGCCGCAACAGAACTCAACTAACTACTCTTTCTACGACAAACTCGGCTACGATCTTTCAAATGCCTGCGAGCCTGCGAGGGCTACTATACTATCATATCACCCAGTGTCCAGACTTGTATGTATTTGTCAGTCCAAGCTACATCATCAAACACCACGTCCTGTATACAGGGTATACAGGATGCTTGCCAGACCCCAGACCCCTGATCAATGGCGTTATATACATGGGATGCTACAGCGGTGTCTCGTGTCTCGGGTATAGCAGCCAGTTT

Full Affymetrix probeset data:

Annotations for 1629434_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime