FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629435_at:

>probe:Drosophila_2:1629435_at:205:727; Interrogation_Position=107; Antisense; TTGTCGAGGATCACGCTCGCAAGTT
>probe:Drosophila_2:1629435_at:577:479; Interrogation_Position=13; Antisense; GTTTCGATCATCTGCTGCCTGCTGT
>probe:Drosophila_2:1629435_at:91:111; Interrogation_Position=182; Antisense; AGAAGGCTGACTACATCCAGTGCCC
>probe:Drosophila_2:1629435_at:249:593; Interrogation_Position=265; Antisense; TGGGTCGAGCCCTACACCAAATAAA
>probe:Drosophila_2:1629435_at:256:165; Interrogation_Position=283; Antisense; AAATAAACAGCCAACTTTCGCACTC
>probe:Drosophila_2:1629435_at:642:695; Interrogation_Position=298; Antisense; TTTCGCACTCTTGCTGAACGTCTAA
>probe:Drosophila_2:1629435_at:579:657; Interrogation_Position=320; Antisense; TAAGCCGTTTATGTTTCCTTTCTGC
>probe:Drosophila_2:1629435_at:438:277; Interrogation_Position=337; Antisense; CTTTCTGCCGCCAAGTTTTGATTGG
>probe:Drosophila_2:1629435_at:172:541; Interrogation_Position=360; Antisense; GGATTCGATTGGATTTACGGCTCAG
>probe:Drosophila_2:1629435_at:642:705; Interrogation_Position=374; Antisense; TTACGGCTCAGTGGTGGTTGGATCA
>probe:Drosophila_2:1629435_at:113:245; Interrogation_Position=418; Antisense; AATTATGTGTCCTGGCACACAGTCA
>probe:Drosophila_2:1629435_at:307:567; Interrogation_Position=431; Antisense; GGCACACAGTCAAACAACTCTATGT
>probe:Drosophila_2:1629435_at:3:251; Interrogation_Position=76; Antisense; CAAGACATCTATGCCGAGCCCAATT
>probe:Drosophila_2:1629435_at:517:321; Interrogation_Position=93; Antisense; GCCCAATTGCGCCATTGTCGAGGAT

Paste this into a BLAST search page for me
TTGTCGAGGATCACGCTCGCAAGTTGTTTCGATCATCTGCTGCCTGCTGTAGAAGGCTGACTACATCCAGTGCCCTGGGTCGAGCCCTACACCAAATAAAAAATAAACAGCCAACTTTCGCACTCTTTCGCACTCTTGCTGAACGTCTAATAAGCCGTTTATGTTTCCTTTCTGCCTTTCTGCCGCCAAGTTTTGATTGGGGATTCGATTGGATTTACGGCTCAGTTACGGCTCAGTGGTGGTTGGATCAAATTATGTGTCCTGGCACACAGTCAGGCACACAGTCAAACAACTCTATGTCAAGACATCTATGCCGAGCCCAATTGCCCAATTGCGCCATTGTCGAGGAT

Full Affymetrix probeset data:

Annotations for 1629435_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720