FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629438_at:

>probe:Drosophila_2:1629438_at:90:371; Interrogation_Position=1021; Antisense; GAAGTGACTTCCCTCTTGAAATTGT
>probe:Drosophila_2:1629438_at:95:179; Interrogation_Position=1054; Antisense; AAACTAATCCACGAATTCCTCAGAA
>probe:Drosophila_2:1629438_at:83:111; Interrogation_Position=1075; Antisense; AGAATAATCAATCCTGCTCTCGACC
>probe:Drosophila_2:1629438_at:224:337; Interrogation_Position=1090; Antisense; GCTCTCGACCCTTTTCCAAATGTTT
>probe:Drosophila_2:1629438_at:26:53; Interrogation_Position=1109; Antisense; ATGTTTTTTCAATCGATCTACTCAG
>probe:Drosophila_2:1629438_at:695:37; Interrogation_Position=1124; Antisense; ATCTACTCAGTTCTTGTTCTCCAAG
>probe:Drosophila_2:1629438_at:141:387; Interrogation_Position=608; Antisense; GAACAGATCCAGCAATCCGAAGCGA
>probe:Drosophila_2:1629438_at:343:155; Interrogation_Position=648; Antisense; ACACGAACGTGTTTGCTTCTTCGAA
>probe:Drosophila_2:1629438_at:456:601; Interrogation_Position=661; Antisense; TGCTTCTTCGAATTTTTGACCTCCC
>probe:Drosophila_2:1629438_at:146:365; Interrogation_Position=709; Antisense; GAATATACCTCGATTTTAAGCCAGA
>probe:Drosophila_2:1629438_at:408:437; Interrogation_Position=832; Antisense; GATGGCAGTTTTGTATTCCCTAGTT
>probe:Drosophila_2:1629438_at:505:383; Interrogation_Position=916; Antisense; GAACTGCTTTTGTGGACTTTTCACT
>probe:Drosophila_2:1629438_at:39:559; Interrogation_Position=978; Antisense; GGACATTTCTTATTGCTTGTCGCTA
>probe:Drosophila_2:1629438_at:563:343; Interrogation_Position=992; Antisense; GCTTGTCGCTATTGAATTTCCCTGT

Paste this into a BLAST search page for me
GAAGTGACTTCCCTCTTGAAATTGTAAACTAATCCACGAATTCCTCAGAAAGAATAATCAATCCTGCTCTCGACCGCTCTCGACCCTTTTCCAAATGTTTATGTTTTTTCAATCGATCTACTCAGATCTACTCAGTTCTTGTTCTCCAAGGAACAGATCCAGCAATCCGAAGCGAACACGAACGTGTTTGCTTCTTCGAATGCTTCTTCGAATTTTTGACCTCCCGAATATACCTCGATTTTAAGCCAGAGATGGCAGTTTTGTATTCCCTAGTTGAACTGCTTTTGTGGACTTTTCACTGGACATTTCTTATTGCTTGTCGCTAGCTTGTCGCTATTGAATTTCCCTGT

Full Affymetrix probeset data:

Annotations for 1629438_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720