FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1629439_at:

>probe:Drosophila_2:1629439_at:414:261; Interrogation_Position=1594; Antisense; CACCGTCGTCAGAAAGCACACTTTG
>probe:Drosophila_2:1629439_at:92:239; Interrogation_Position=1626; Antisense; AATACCCAATTTTTCAGGACGCTGT
>probe:Drosophila_2:1629439_at:453:73; Interrogation_Position=1641; Antisense; AGGACGCTGTTCTGGTTGCCTAAAG
>probe:Drosophila_2:1629439_at:36:623; Interrogation_Position=1657; Antisense; TGCCTAAAGTTTTTTCGATCCCGCT
>probe:Drosophila_2:1629439_at:381:593; Interrogation_Position=1682; Antisense; TGGGTCTTCGCCAGCATATGCGATA
>probe:Drosophila_2:1629439_at:488:151; Interrogation_Position=1706; Antisense; ACATATGTCAATCGTTGTCGCTCAA
>probe:Drosophila_2:1629439_at:655:711; Interrogation_Position=1745; Antisense; TTCAGAGCTTCAAGTGTCGCCACTG
>probe:Drosophila_2:1629439_at:25:143; Interrogation_Position=1790; Antisense; ACTGGCGCCTGTATCGTCGTCATGA
>probe:Drosophila_2:1629439_at:84:475; Interrogation_Position=1879; Antisense; GTTACGCCCACCCAAGTATTTGAGT
>probe:Drosophila_2:1629439_at:222:185; Interrogation_Position=1917; Antisense; AAAATCATTCGGTTCGCTCAACGGA
>probe:Drosophila_2:1629439_at:233:331; Interrogation_Position=1988; Antisense; GCGGCATCTGTGAGCGGGTCTTCAA
>probe:Drosophila_2:1629439_at:268:409; Interrogation_Position=2015; Antisense; GACGCAACGGATTGTCTCAACACAT
>probe:Drosophila_2:1629439_at:268:205; Interrogation_Position=2062; Antisense; AAGCCGCATGAGTGTCCGGTTTGCC
>probe:Drosophila_2:1629439_at:217:11; Interrogation_Position=2129; Antisense; ATTCCCTGCGAAAAGGTCCAGCTGC

Paste this into a BLAST search page for me
CACCGTCGTCAGAAAGCACACTTTGAATACCCAATTTTTCAGGACGCTGTAGGACGCTGTTCTGGTTGCCTAAAGTGCCTAAAGTTTTTTCGATCCCGCTTGGGTCTTCGCCAGCATATGCGATAACATATGTCAATCGTTGTCGCTCAATTCAGAGCTTCAAGTGTCGCCACTGACTGGCGCCTGTATCGTCGTCATGAGTTACGCCCACCCAAGTATTTGAGTAAAATCATTCGGTTCGCTCAACGGAGCGGCATCTGTGAGCGGGTCTTCAAGACGCAACGGATTGTCTCAACACATAAGCCGCATGAGTGTCCGGTTTGCCATTCCCTGCGAAAAGGTCCAGCTGC

Full Affymetrix probeset data:

Annotations for 1629439_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720